EHU000091

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD1

NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTCTGATGGAAATGCCACTTCCCTGGCTGAGACCATAGACAACTGTGACTCCAGCCTCAGCAGGACATATGCCATCTCATCCTCTGTAATAAGCTTTTACATCCCTGTGGCCATCATGATTGTCACCTACACCAGGATCTACAGGATTGCTCAGAAACAAATACGGCGCATTGCGGCCTTGGAGAGGGCAGCAGTCCACGCCAAGAATTGCCAGACCACCACAGGTAATGGAAAGCCTGTCGAATGTTCTCAACCGGAAAGTTCTTTTAAGATGTCCTTCAAAAGAGAAACTAAAGTCCTGAAGACTCTGTCGGTGATCATGGGTGTGTTTGTGTGCTGTTGGCTACCTTTCTTCATCTTGAACTGCATTTTGCCCTTCTGTGGGTCTGGGGAGACGCAGCCCTTCTGCATTGATTCCAACACCTTTGACGTGTTTGTGTGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

enviado em

ambient

temperatura de armazenamento

−20°C

Gene Information

human ... DRD1(1812), DRD1(1812)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Ponto de fulgor (ºF)

Not applicable

Ponto de fulgor (ºC)

Not applicable

Certificado de análise
Certificado de origem
Shengzhi Liu et al.
Cancer research, 78(14), 3865-3876 (2018-05-18)
While bone is a frequent target of breast cancer-associated metastasis, little is known about the effects of tumor-bone interactions on the efficacy of tumor-suppressing agents. Here we examined the effect of two FDA-approved dopamine modulators, fluphenazine and trifluoperazine, on mammary...
Kazumasa Minami et al.
Scientific reports, 7, 45686-45686 (2017-04-05)
Dopaminergic signaling plays a critical role in the nervous system, but little is known about its potential role in breast cancer and bone metabolism. A screening of ~1,000 biologically active compounds revealed that a selective agonist of dopamine receptor D1...
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R)....
null

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica

Redes sociais

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Pesquisa. Desenvolvimento. Produção.

Somos um fornecedor global líder para o setor de ciências biológicas, com soluções e serviços para pesquisa, desenvolvimento e produção de biotecnologia, além de produção e desenvolvimento de terapias farmacológicas com medicamentos.

© 2021 Merck KGaA, Darmstadt, Alemanha e/ou suas filiais. Todos os direitos reservados.

A reprodução não autorizada de quaisquer materiais deste site é estritamente proibida.