EHU014871

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP3

NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGGCTTTCCCAAGCAAATAGCTGAAGACTTTCCAGGGATTGACTCAAAGATTGATGCTGTTTTTGAAGAATTTGGGTTCTTTTATTTCTTTACTGGATCTTCACAGTTGGAGTTTGACCCAAATGCAAAGAAAGTGACACACACTTTGAAGAGTAACAGCTGGCTTAATTGTTGAAAGAGATATGTAGAAGGCACAATATGGGCACTTTAAATGAAGCTAATAATTCTTCACCTAAGTCTCTGTGAATTGAAATGTTCGTTTTCTCCTGCCTGTGCTGTGACTCGAGTCACACTCAAGGGAACTTGAGCGTGAATCTGTATCTTGCCGGTCATTTTTATGTTATTACAGGGCATTCAAATGGGCTGCTGCTTAGCTTGCACCTTGTCACATAGAGTGATCTTTCCCAAGAGAAGGGGAAGCACTCGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

enviado em

ambient

temperatura de armazenamento

−20°C

Gene Information

human ... MMP3(4314), MMP3(4314)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Ponto de fulgor (ºF)

Not applicable

Ponto de fulgor (ºC)

Not applicable

Certificado de análise
Certificado de origem
Yu Jin et al.
Journal of Cancer, 10(12), 2720-2734 (2019-07-02)
MicroRNA-519d (miR-519d) has been reported to play important roles in tumor development and progression in multiple cancers, either as tumor suppressor or tumor promotor. However, the expression level, biological function and molecular mechanisms of miR-519d in oral squamous cell carcinoma...
Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells...
Yu Deng et al.
Scientific reports, 10(1), 1386-1386 (2020-01-30)
High estrogen concentration leads to an inflammatory reaction in the mammary gland tissue in vivo; however, the detailed mechanism underlying its specific effects on the breast duct has not been fully clarified. We used 3D-cultured MCF-10A acini as a breast...
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of...
N Ozeki et al.
Oral diseases, 20(5), 505-513 (2013-08-02)
Matrix metalloproteinase (MMP)-3 expression increases after pulpectomy and accelerates angiogenesis in rat dental pulp by an uncharacterised mechanism. Odontoblasts, a major component of dental pulp, could represent a therapeutic target. We investigated whether MMP-3 activity is induced by cytokines and/or...

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica

Redes sociais

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Pesquisa. Desenvolvimento. Produção.

Somos um fornecedor global líder para o setor de ciências biológicas, com soluções e serviços para pesquisa, desenvolvimento e produção de biotecnologia, além de produção e desenvolvimento de terapias farmacológicas com medicamentos.

© 2021 Merck KGaA, Darmstadt, Alemanha e/ou suas filiais. Todos os direitos reservados.

A reprodução não autorizada de quaisquer materiais deste site é estritamente proibida.