Merck
All Photos(1)

EMU024031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tesc

NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGTCACGAAAGGAGAAGCTGAAATTTCTGTTTCATATGTATGATTCGGACAGTGACGGCCGCATCACCCTGGAAGAGTATAGAAATGTGGTGGAGGAGCTGCTCTCGGGAAACCCTCACATTGAAAAGGAGTCGGCTCGGTCCATTGCAGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCGTGGGGCAGATGGAACCGGACCAGGTGTACGAGGGGATCACCTTTGAGGACTTCCTGAAGATCTGGCAGGGCATCGACATCGAGACCAAGATGCACATTCGTTTCCTCAACATGGAGACCATCGCCCTCTGCCACTGACCTGCTGCCTGCTGCCCGTGCAAGGGAGGGGGTGGCTGGAAGCTGGGGGTGACCGAGGACGGATGTTCAGCCCTATGCCTGGGCTTCTGTGACAATCAGTAACCCTTCTTCAGTTATCCTCCTCGTGGG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

enviado em

ambient

temperatura de armazenamento

−20°C

Gene Information

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (ºF)

Not applicable

Ponto de fulgor (ºC)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service