Merck
Todas as fotos(1)

Documentos

EMU146131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Zfp273

Faça loginto View Organizational & Contract Pricing

Select a Size

Change View

Select a Size

Change View
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAGAAAACTCAGATTAGTACAACCATGTTGCAAAGCCTTCCATAATCATTTACTGATAATTCGACACTAAAGAATTCATATGAGAGGGGAACTTTAGAAATGAAAGGAACAAGGGAAGACCTTTAATAATAGCTCAACTCTTATTCACCCTCTTCCATTAAACGGAGGAGAAATCTTGTAATGTGAAGAAGATGGCTGTAATGAACAATCTATACTTATGAAACATCAAAATTTTCATTTTACAGAAACCCTGCAAATGCAAGTAATGGGGGAAATGCACACTCACCACGAGTGAATTATAATCAAACTGTATACATGCATAATGACTCGGGAAGGAACACTGTCAAGTACATAAAACTGAGACAACCGAACTCTTACAGTAAGAAGCACTGTGTACACTGTGTTGCAAGAGCACATGGATCTTAAGAGATATAAGAGACAAATCCCAGGAGTTGTATAGAATTTTAGCAAAGCAACAAATACTGCTTATAACCGGCAGGAAAATGTTT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Gene Information

Comparar Itens Semelhantes

Ver Comparação Total

Mostrar diferenças

1 of 4

Este Item
EMU036681EMU019851EMU202141
MISSION® esiRNA targeting mouse Zfp273

Sigma-Aldrich

EMU146131

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zfp282

Sigma-Aldrich

EMU036681

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zfp277

Sigma-Aldrich

EMU019851

MISSION® esiRNA

MISSION® esiRNA targeting mouse Zfp773

Sigma-Aldrich

EMU202141

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGAGAAAACTCAGATTAGTACAACCATGTTGCAAAGCCTTCCATAATCATTTACTGATAATTCGACACTAAAGAATTCATATGAGAGGGGAACTTTAGAAATGAAAGGAACAAGGGAAGACCTTTAATAATAGCTCAACTCTTATTCACCCTCTTCCATTAAACGGAGGAGAAATCTTGTAATGTGAAGAAGATGGCTGTAATGAACAATCTATACTTATGAAACATCAAAATTTTCATTTTACAGAAACCCTGCAAATGCAAGTAATGGGGGAAATGCACACTCACCACGAGTGAATTATAATCAAACTGTATACATGCATAATGACTCGGGAAGGAACACTGTCAAGTACATAAAACTGAGACAACCGAACTCTTACAGTAAGAAGCACTGTGTACACTGTGTTGCAAGAGCACATGGATCTTAAGAGATATAAGAGACAAATCCCAGGAGTTGTATAGAATTTTAGCAAAGCAACAAATACTGCTTATAACCGGCAGGAAAATGTTT

esiRNA cDNA target sequence

TGGAGAACCTGGAGAACCTGCTTCGCAACAGGAACTTCTGGGTCCTGCGGCTGCCCCCTGGCAGCAAGGGGGAGGCCCCCAAGGTCCCGGTGACCTTCGTCGACATTGCTGTCTACTTCTCTGAGGACGAATGGAAGAACTTGGACGAATGGCAGAAGGAGCTCTACAGCAATCTGGTGAAGGAGAACTACAAAACCCTGATGTCCCTGGACACAGATGGCCCAGTGTCCAAGCCAGACCCTCCGGTCCAGGCAGAACCCAGGGAAGAGCCTTGTGTGTGGGAGCAGCATCACCCCGAAGAGAGAGAAATCCCAGTGACTGCAGACACAGGAACAGAGACTCTGGTGCCGGCACAGGACATATCCTCCCAGGTAAAGCGAGAAGAAGCCCTGTGTGTTCGGGGCCAGAGGGGCCTGGAAGACAGAGCCATCCCCACAGAATCCATCACTGACTCCCCCATCTCTGCCCAGGACCTTTTGTCCCGGATTAAGCAG

esiRNA cDNA target sequence

CAGCAAGTGAAGCTGGTCAATTTCATTAGAAGGCAAGTTCACCAATGCAAGTGCTACAGTTGCCATGTAAAGTTCAAATCCAAAGCAGATTTAAGGACTCACATGGAAGACACTAAACACACCTCACTGCTTCCTGACAGGAAGACATGGGATCAACTGGAGTATTATTTCCCCACCTATGAGAATGACACTCTCCTGTGTACACTGTCTGACAGTGAAAGTGACCTAACAGCTCAAGAGCAAACGGAAAATGTCCCCGTCATCAGTGAAGATACGTCCAGACTGTGTGCTTTAAAACAGAGCAGTGTTCTCAACCAATTGCTACTCCAGGGGTGCCTGGAAAACTAGGAGAAGCTGCTGCAGGCACAGTGTCACCTGGTTTTCTCCTGTGAGACACAGACAAGTTCAGATTTGATTGTCCACACAGCATTATTCACGG

esiRNA cDNA target sequence

GATGAGAATTAGTGCCATCTTCTTATTCCTATGAAGTTAATGCTTTCTGGGGAATTAGCAAGAGGAAGCCGTGTTCTTGACTGCACCAGAATGGGATGCAATCTCCATGTTACTGAGTGTGAATGGGGGAGGAAGAAAGTGACCTCGGTTTAAATAAGACATATATTTGTTGCTGCTACTGCTGTTGTTTGTTTGCTTGCTTGCTTGCTTTGTTTTTTCCCTCACTGAATATTGCAGTCCGTGGGATAAATGATCATTTACTGTAAAGTCTTCATGACTATTGTGTACTTAAGTGTCACTAATTTTGTTGGGGACTAGCTCTGTGTAGCACCTTATGCCCTCTTGTAGGCATATAGCCCATATGTTTTAAGTATGTGTTGCTTTCTTGGGTATGTTTTGTCTGTGTATATGTAGATACAGTGAATATGTGCCTGATGGTTATGAAGGTCCAAAAAAGGCATTTGTTTCCTAGAACTGGAATTACAGTTGGGTATGAACCAGTATGTTTGCTGGA

Ensembl | mouse accession no.

ENSMUSG00000030446

Ensembl | mouse accession no.

ENSMUSG00000025821

Ensembl | mouse accession no.

ENSMUSG00000055917

Ensembl | mouse accession no.

ENSMUSG00000063535

NCBI accession no.

NM_198322

NCBI accession no.

NM_146175

NCBI accession no.

NM_178845

NCBI accession no.

NM_029584

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Os números dos produtos são combinados com os tamanhos/quantidades da embalagem quando exibidos no site (exemplo: T1503-25G). Por favor, certifique-se você insere APENAS o número do produto no campo Número do produto (exemplo: T1503).

Exemplo

T1503
Número do produto
-
25G
Tamanho/quantidade da embalagem

Exemplos adicionais:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

inserir como 1.000309185)

Está com problemas? Sinta-se à vontade para entrar em contato Assistência Técnica para obter assistência

Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Produtos Aldrich

  • Se encontrar um número de lote como TO09019TO - insira o número do lote 09019TO sem as duas primeiras letras.

  • Se encontrar um número de lote com um código de preenchimento, como 05427ES-021 - insira o número do lote 05427ES sem o código de preenchimento -021.

  • Se encontrar um número de lote com um código de preenchimento como STBB0728K9 - digite o número do lote STBB0728 sem o código de preenchimento K9.

Não encontra o que está procurando?

Em alguns casos, um COA pode não estar disponível on-line. Se a sua pesquisa não encontrou o COA, você pode solicitar um.

Solicitar COA

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica