The 3'/5' Assay for Analysis of RNA Integrity Protocol
Quantitative PCR Protocols
Although quantitative PCR uses the same basic concept as traditional PCR, the reactions differ in that the amplicons are generally smaller and are detected indirectly using an additional dye or labeled probe or primer.
The 3’/5’ integrity assay is a potential first step in the identification of RNA degradation. The assay is particularly useful when a large number of samples are to be analyzed or when the degradation is less than that detected by capillary systems but still sufficient to effect qPCR analyses.
One or more target RNA sequences are selected, and in this example GAPDH is used. Two assays are designed along the length of the target such that one is located close to the 3’ UTR and the second is approximately 1 kb upstream. cDNA is generated using reverse transcription from an anchored oligo-dT primer. Following amplification by qPCR, the products from each assay are quantified and the ratio of the quantities is compared to that derived from a sample using high quality RNA. Degradation of the template results in a relative decrease in product, especially with assays near the 5’ end of the target gene. This results in an increase in the 3’/5’ ratio.
In the following test, the optimized conditions for the example assays are provided. It may be necessary to alter these conditions following optimization of assays to the targets that are more appropriate for the experiment (see Assay Optimization and Validation, Primer Concentration Optimization and Primer Optimization Using Temperature Gradient that describe the process of assay optimization and validation).
Equipment
- Quantitative PCR instrument
- Laminar flow hood for PCR set up (optional)
Reagents
- cDNA prepared using anchored oligo-dT (O4387) priming (HSRT100 or STR1).
- LuminoCt ReadyMix for Quantitative PCR (L6669).
- PCR grade water: PCR grade water (W1754 or W4502) as 20 mL aliquots; freeze; use a fresh aliquot for each reaction.
Supplies
- Sterile filter pipette tips
- Sterile 1.5 mL screw-top microcentrifuge tubes (CLS430909)
- PCR tubes and plates, select one to match desired format:
• Individual thin-walled 200 μL PCR tubes (Z374873 or P3114)
• Plates
- 96-well plates (Z374903)
- 384-well plates (Z374911)
• Plate seals
- ThermalSeal RTS™ Sealing Films (Z734438)
- ThermalSeal RT2RR™ Film (Z722553)
- cDNA generated using an Oligo-dT method diluted 1:10 (see Reverse Transcription).
- 3’ and 5’ assay forward and reverse primers for target gene (human GAPDH sequences are used as an example) at 50 μM (Table P9-23).
- 3’ and 5’ Amplicon specific probes at 10 μM (Table P9-23).
| Primer/Probe | Sequence |
|---|---|
| GAPDH 5’ Forward | GTGAACCATGAGAAGTATGACAAC |
| GAPDH 5’ Reverse | CATGAGTCCTTCCACGATACC |
| GAPDH 3’ Forward | AGTCCCTGCCACACTCAG |
| GAPDH 3’ Reverse | TACTTTATTGATGGTACATGACAAGG |
| GAPDH 5’ Probe | [FAM]CCTCAAGATCATCAGCAATGCCTCCTG[BHQ1] |
| GAPDH 3’ Probe | [JOE] or [HEX] — instrument specific CCCACCACACTGAATCTCCCCTCCT[BHQ1] |
Method
1. Place all the reaction components on ice to defrost.
2. Mix and then centrifuge briefly to collect contents at the bottom of the tube.
3. Calculate the number of reactions required, running two reactions per test sample and also two No Template Controls
(NTC). Calculating the requirements for the number of reactions plus 10% extra to allow for pipetting error
(Table P9-24).
4. Prepare master mix that is sufficient for all samples and controls according to Table P9-24. Mix well and centrifuge
briefly to collect contents at the bottom of the tube.
| Reagents | Volume (μL) per Single 25 μL Reaction |
|---|---|
| 2× LuminoCt ReadyMix | 12.5 |
| Primer 3’ F (50 μM stock) | 0.15 |
| Primer 3’ R (50 μM stock) | 0.15 |
| Primer 5’ F (50 μM stock) | 0.15 |
| Primer 5’ R (50 μM stock) | 0.15 |
| Probe 3’ (10 μM stock) | 0.5 |
| Probe 5’ (10 μM stock) | 0.5 |
| Reference dye (optional) | 1.0 |
| PCR grade water | 4.9 |
5. Aliquot 20 μL of qPCR master mix into the PCR tubes/wells. If using a PCR plate, follow a plate schematic to
ensure that the reagents and controls are added to the correct wells.
6. Add 5 μL cDNA sample into qPCR tubes/wells.
7. Cap tubes or seal the PCR plate and label. (Make sure the labeling does not obscure instrument
excitation/detection light path.)
8. Samples should be run according to the three-step protocol provided in Table P9-25. Following the initial hot
start, steps 1–3 are repeated through 40 cycles.
Note: The conditions on Table P9-25 are optimal for the human GAPDH example assay given. However it may be appropriate to run alternative assays using the two-step protocol as described in Table P9-25B.
| Cycling Conditions | Temp (°C) | Time (sec) |
|---|---|---|
| Initial Hot Start/denaturation | 95 | 30 |
| Steps 1–3 are repeated through 40 cycles | ||
| Step 1 | 95 | 5 |
| Step 2 | 55 | 15 |
| Step 3 | 72 | 10 |
| FAST Cycling Conditions | Temp (°C) | Time (sec) |
|---|---|---|
| Initial Hot Start/denaturation | 95 | 30 |
| Steps 1 and 2 are repeated through 40 cycles | ||
| Step 1 | 95 | 5 |
| Step 2 | 60 | 30 |
Materials
Response not successful: Received status code 500
Para continuar lendo, faça login ou crie uma conta.
Ainda não tem uma conta?