Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTTATTCATCGCACTGGTGGTTATGAGGCTTATGATGAGAGTGAGGATGATGCCTCCGATACCAACCCTGATTTCTACATCAATATTTGTCAGCCACTAAATCCCATGCACGGAGTGCCCTGTCCTGCCGGAGCCGCTGTGTGCAAAGTTCCTATTGATGGTCCCCCCATAGATATCGGCCGGGTAGCAGGACCACCAATACTCAATCCAATAGCAAATGAGATTTACTTGAATTTTGAAAGCAGTACTCCTTGCTTAGCGGACAAGCATTTCAACTACACCTCGCTCATCGCGTTTCACTGTAAGAGAGGTGTGAGCATGGGAACGCCTAAGCTGTTAAGGACCAGCGAGTGCGACTTTGTGTTCGAATGGGAGACTCCTGTCGTCTGTCCTGATGAAGTGAGGATGGATGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IGF2R(3482)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Gui Yang et al.
The Journal of allergy and clinical immunology, 133(6), 1702-1708 (2014-04-05)
The functions of regulatory T (Treg) cells are important in immunity, and the regulatory mechanisms of Treg cell activities are not fully understood yet. We sought to investigate the role of insulin-like growth factor (IGF) 2 in the upregulation of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU028581-20UG | 04061831350388 |
| EHU028581-50UG | 04061828342419 |