Merck
All Photos(1)

Documents

EHU055871

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV5

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU069441EHU070491EHU068971
MISSION® esiRNA targeting human ETV5

Sigma-Aldrich

EHU055871

MISSION® esiRNA

MISSION® esiRNA targeting human ETV4

Sigma-Aldrich

EHU069441

MISSION® esiRNA

MISSION® esiRNA targeting human ETV1

Sigma-Aldrich

EHU070491

MISSION® esiRNA

MISSION® esiRNA targeting human ETV3

Sigma-Aldrich

EHU068971

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

esiRNA cDNA target sequence

GGAGACATCAAGCAGGAAGGGGTCGGTGCATTTCGAGAGGGGCCGCCCTACCAGCGCCGGGGTGCCCTGCAGCTGTGGCAATTTCTGGTGGCCTTGCTGGATGACCCAACAAATGCCCATTTCATTGCCTGGACGGGCCGGGGAATGGAGTTCAAGCTCATTGAGCCTGAGGAGGTCGCCAGGCTCTGGGGCATCCAGAAGAACCGGCCAGCCATGAATTACGACAAGCTGAGCCGCTCGCTCCGATACTATTATGAGAAAGGCATCATGCAGAAGGTGGCTGGTGAGCGTTACGTGTACAAGTTTGTGTGTGAGCCCGAGGCCCTCTTCTCTTTGGCCTTCCCGGACAATCAGCGTCCAGCTCTCAAGGCTGAGTTTGACCGGCCTGTCAGTGAGGAGGACACAGTCCCTT

esiRNA cDNA target sequence

CCCCAGGCAGTTTTATGATGACACCTGTGTTGTCCCAGAAAAATTCGATGGAGACATCAAACAAGAGCCAGGAATGTATCGGGAAGGACCCACATACCAACGGCGAGGATCACTTCAGCTCTGGCAGTTTTTGGTAGCTCTTCTGGATGACCCTTCAAATTCTCATTTTATTGCCTGGACTGGTCGAGGCATGGAATTTAAACTGATTGAGCCTGAAGAGGTGGCCCGACGTTGGGGCATTCAGAAAAACAGGCCAGCTATGAACTATGATAAACTTAGCCGTTCACTCCGCTATTACTATGAGAAAGGAATTATGCAAAAGGTGGCTGGAGAGAGATATGTCTACAAGTTTGTGTGTGATCCAGAAGCCCTTTTCTCCATGGCCTTTCCAGATAATCAGCGTCCACTGCTGAAGACAGACATGGAACGTCACATCAACGAGGAGGACACAGTG

esiRNA cDNA target sequence

CCGGGCCCTCAGATACTATTACAACAAGAGGATCCTTCATAAAACAAAAGGGAAAAGATTTACCTATAAATTTAACTTCAACAAGCTGGTGATGCCCAACTACCCATTCATCAACATTCGGTCAAGTGGTGTGGTTCCTCAGAGTGCACCACCAGTGCCAACAGCCTCTTCCCGGTTCCATTTCCCACCTCTGGACACCCATTCTCCAACCAATGATGTGCAGCCGGGACGGTTCTCTGCTAGCTCCCTAACTGCTTCTGGCCAGGAGTCCAGTAATGGTACTGATAGAAAGACTGAGCTTTCAGAGCTGGAGGATGGCTCAGCTGCTGACTGGCGCCGGGGTGTGGATCCCGTGTCCTCCAGGAATGCCATTGGTGGAGGAGGGATTGGCCATCAGAAACGCAAGCCTGAC

Ensembl | human accession no.

ENSG00000171656

Ensembl | human accession no.

ENSG00000175832

Ensembl | human accession no.

ENSG00000006468

Ensembl | human accession no.

ENSG00000117036

NCBI accession no.

NM_004454

NCBI accession no.

NM_001079675

NCBI accession no.

-

NCBI accession no.

NM_005240

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Félicie Cottard et al.
Oncotarget, 8(42), 72008-72020 (2017-10-27)
Constitutively active androgen receptor (AR) variants have been involved in the expression of mesenchymal markers such as N-cadherin in prostate cancer (PCa). However, the underlying molecular mechanisms remain elusive. It remains unclear, whether N-cadherin gene (CDH2) is a direct transcriptional
Duy Pham et al.
The Journal of allergy and clinical immunology, 134(1), 204-214 (2014-02-04)
The differentiation of TH17 cells, which promote pulmonary inflammation, requires the cooperation of a network of transcription factors. We sought to define the role of Etv5, an Ets-family transcription factor, in TH17 cell development and function. TH17 development was examined
Yong Cheng et al.
PLoS pathogens, 16(5), e1008569-e1008569 (2020-05-29)
Mycobacterial infection leads to activation of the RIG-I/MAVS/TBK1 RNA sensing pathway in macrophages but the consequences of this activation remains poorly defined. In this study, we determined that activation of this RNA sensing pathway stimulates ICAM-1 expression in M.avium-infected macrophage
Jong-Min Park et al.
Free radical biology & medicine, 110, 151-161 (2017-06-13)
8-hydroxydeoxyguanosine (8-OHdG) is generated consequent to oxidative stress, but its paradoxical anti-oxidative, anti-inflammatory, and anti-mutagenic effects via Rho-GTPase inhibition were noted in various models of inflammation and cancer. Metastasis occurs through cell detachment, epithelial-mesenchymal transition (EMT), and cell migration; during
Oorvashi Roy Puli et al.
Neoplasia (New York, N.Y.), 20(11), 1121-1134 (2018-09-29)
The ETS family of transcription factors is involved in several normal remodeling events and pathological processes including tumor progression. ETS transcription factors are divided into subfamilies based on the sequence and location of the ETS domain. ETV5 (Ets variant gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service