Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
| Pack Size | SKU | Availability | Price |
|---|---|---|---|
| 20 μg | Please contact Customer Service for Availability | 1.700,00 kr. | |
| 50 μg | Please contact Customer Service for Availability | 3.010,00 kr. |
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
1.700,00 kr.
Please contact Customer Service for Availability
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
shipped in
ambient
storage temp.
−20°C
General description
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Other Notes
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
1 of 1
This Item | |||
|---|---|---|---|
| product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| form lyophilized powder | form lyophilized powder | form lyophilized powder | form lyophilized powder |
| description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
Storage Class
10 - Combustible liquids
wgk
WGK 1
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Articles
esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.
Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHURLUC-20UG | 04061831376661 |
| EHURLUC-50UG | 04061831376678 |
