Saltar al contenido
Merck

EHU072491

MISSION® esiRNA

targeting human ADGRL3

Iniciar sesiónpara ver los posibles precios especiales de su organización

Seleccione un Tamaño

Acerca de este artículo

Código UNSPSC:
41105324
NACRES:
NA.51

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGCAGTAGATGAGAATGGGCTATGGGTAATCTATGCAACAGAACAAAACAATGGTAAAATTGTCATTAGTCAATTGAACCCTTACACCCTACGGATCGAAGGAACATGGGATACTGCATATGATAAAAGGTCAGCTTCCAATGCCTTTATGATTTGTGGAATTCTGTATGTGGTCAAATCTGTATATGAGGATGATGACAATGAGGCTACTGGAAATAAGATTGACTACATTTACAACACTGACCAAAGCAAGGATAGTTTGGTGGATGTACCCTTTCCTAATTCATACCAGTACATTGCAGCTGTGGATTACAACCCCAGGGACAACCTACTTTATGTATGGAATAACTATCACGTCGTGAAATATTCTTTGGATTTTGGACCTCTGGATAGTAGATCAGGGCAGGCACATCATGGACAAGTTTCATACATTTCTCCGCCAATTCAC

Ensembl | nº de acceso humano

ENSG00000150471

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADGRL3(23284), LPHN3(23284)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Juliane Röthe et al.
Cell reports, 26(6), 1573-1584 (2019-02-07)
Insulin secretion from pancreatic β cells is a highly complex and tightly regulated process. Its dysregulation is one characteristic of type 2 diabetes, and thus, an in-depth understanding of the mechanisms controlling insulin secretion is essential for rational therapeutic intervention.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico