Merck
Todas las fotos(1)

EHU144261

Sigma-Aldrich

MISSION® esiRNA

targeting human KIAA1549L

Iniciar sesiónto View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCACCACAAGTTGGGAAACTCATTTAGCTCCAACAGCTCCTCCCAATGGTTTAACTTCAGCTGCCGATGCCATAAAATCTCAGGATTTCAAAGATACTGCTGGGCATTCAGTGACTGCAGAAGGGTTTAGTATTCAGGATCTAGTCCTCGGTACAAGCATTGAGCAGCCTGTGCAACAGTCAGACATGACCATGGTTGGAAGCCATATAGACCTCTGGCCCACAAGCAATAACAACCATTCCAGAGACTTCCAAACAGCTGAAGTTGCATATTACTCACCCACAACTCGACATTCCGTGTCTCATCCTCAGCTACAGTTGCCCAACCAGCCAGCACATCCTCTTTTGCTAACCTCACCAGGACCAACTTCTACAGGTAGCTTGCAGGAAATGCTTTCAGATGGAACAGATACAGGTTCTGAAATTTCCAGTGACATCAATTCATCACCTGAGAGAAATGCTTCCACACCATTCCAGAACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Gene Information

Categorías relacionadas

Comparar elementos similares

Ver comparación completa

Mostrar Diferencias

1 of 4

Este artículo
EHU133351EHU020561EHU104601
MISSION® esiRNA targeting human KIAA1549L

Sigma-Aldrich

EHU144261

MISSION® esiRNA

MISSION® esiRNA targeting human DSTYK

Sigma-Aldrich

EHU133351

MISSION® esiRNA

MISSION® esiRNA targeting human C11ORF45

Sigma-Aldrich

EHU020561

MISSION® esiRNA

MISSION® esiRNA targeting human CHORDC1

Sigma-Aldrich

EHU104601

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCACAAGTTGGGAAACTCATTTAGCTCCAACAGCTCCTCCCAATGGTTTAACTTCAGCTGCCGATGCCATAAAATCTCAGGATTTCAAAGATACTGCTGGGCATTCAGTGACTGCAGAAGGGTTTAGTATTCAGGATCTAGTCCTCGGTACAAGCATTGAGCAGCCTGTGCAACAGTCAGACATGACCATGGTTGGAAGCCATATAGACCTCTGGCCCACAAGCAATAACAACCATTCCAGAGACTTCCAAACAGCTGAAGTTGCATATTACTCACCCACAACTCGACATTCCGTGTCTCATCCTCAGCTACAGTTGCCCAACCAGCCAGCACATCCTCTTTTGCTAACCTCACCAGGACCAACTTCTACAGGTAGCTTGCAGGAAATGCTTTCAGATGGAACAGATACAGGTTCTGAAATTTCCAGTGACATCAATTCATCACCTGAGAGAAATGCTTCCACACCATTCCAGAACA

esiRNA cDNA target sequence

GGTTGTTCCCAGACCAAAGAGAGTCACTTTTGACTCCATCAACTTCAAGGGGACAGAGCCTAGGCAGCAGATTCTCCTAATTTTTAACACTAAAATTCAAGGAAGCAGTGGAGGAAAGAATGCATTACTACCACAGATAGAAATAGGGGACTCATAGAACTCTCGACTAGTACCTGTCAGCTCTCAAATGCATTCTTGTGTCTTTGCTTGAGCTGCCAAAGAAGGGTCACAAAGTGTTCTTCCTCATGGAAGAAGTGCCTCGGGGTTGCAGGGCTGCAAAGTGACAACTGCACTGAATGACACTTTATTTTTTGGCTTTGGCTTATTATTTAGCACTGGGAGGCCCAGGGGAATTGGTGATTACAGTAGCACTTTGGGAAGTTAAAGCCCCCTTTGGGCTTGCTTTGGAGAGATGATGGCATGCTTGGTATTCCATTTGGATAATCAGGAAGCCTCCC

esiRNA cDNA target sequence

AACGTGCTGATGCCTAGTCCCAGAATCTGGCCCCAGGTGACTCCAACAGGCAGGTCTGCCTCTGTCAGGAGTGAGGGTAACACCTCCTCACTCTGGAATTTCTCAGCTGGGCAGGATGTGCATGCCATAGTAACCAGAACCTGTGAGTCTGTGCTGAGCTCTGCCGTCTACACCCACGGCTGTGGCTGTGTGAGGTCTGCCACAAACATTACCTGTCAGTCCTCAGGACAACAAAGGCAGGCGGCCCGGCAGGAAGAGGAGAACTCAATCTGCAAGGCCCATGATAGTAGAGAGGGCCGCCTGGGCTACCCCCTCAGTGCCCATCAGCCTGGTTCCGGTGGTCCTAACTAGCCCTGTCTCCTTGCCAATAGCCCTGTGCTCCCCAGCCCCCTCCCCCATGCAGACGGCTGCTATGACATCCCTGTTCCTTAAAGTGCGGGGTTCCTCGCTGCCTTCTCCTCCCTAACTGGCACCCTGTGCAAACCTGCTGCAGAGAACA

esiRNA cDNA target sequence

AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG

Ensembl | human accession no.

ENSG00000110427

Ensembl | human accession no.

ENSG00000133059

Ensembl | human accession no.

ENSG00000174370

Ensembl | human accession no.

ENSG00000110172

NCBI accession no.

NM_012194

NCBI accession no.

NM_015375

NCBI accession no.

NM_145013

NCBI accession no.

NM_012124

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Las referencias de los producto se combinan con los tamaños de envase y las cantidades cuando se muestran en la página web, por ejemplo: T1503-25G. Asegúrese de introducir el número de producto ÚNICAMENTE en el campo del Número de producto (ejemplo: T1503).

Ejemplo

T1503
Referencia del producto
-
25G
Tamaño del envase/cantidad

Otros ejemplos

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

introducir como 1.000309185)

¿Tiene algún problema? No dude en ponerse en contacto con nosotros Servicio técnico para asistencia

Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch».

Productos Aldrich

  • Si encuentra un número de lote como TO09019TO, introduzca el número de lote 09019TO sin las dos primeras letras.

  • Si encuentra un número de lote con un código de entrada como 05427ES-021, introduzca el número 05427ES sin el código de entrada -021.

  • Si encuentra un número de lote con un código de entrada como STBB0728K9, introduzca el código de lote STBB0728 sin el código de entrada K9.

¿No ha encontrado lo que estaba buscando?

En algunos casos, puede que un COA no esté disponible en la página web. Si su búsqueda no encontró el COA puede solicitarlo.

Solicitar COA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico