EMU002641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdk4

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAAGATCCCCTGCTTCGAGAATGGCTGCCACTCGATATGAACCCGTGGCTGAAATTGGTGTCGGTGCCTATGGGACGGTGTACAAAGCCCGAGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTTCCTAATGGAGGAGCAGCTGGAGGGGGCCTTCCCGTCAGCACAGTTCGTGAGGTGGCCTTGTTAAGGAGGCTGGAGGCCTTTGAACATCCCAATGTTGTACGGCTGATGGATGTCTGTGCTACTTCCCGAACTGATCGGGACATCAAGGTCACCCTAGTGTTTGAGCATATAGACCAGGACCTGAGGACATACCTGGACAAAGCACCTCCACCGGGCCTGCCGGTTGAGACCATTAAGGATCTAATGCGTCAGTTTCTAAGCGGCCTG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Certificado de origen

Guoyan Liu et al.
The Journal of pathology, 233(3), 308-318 (2014-03-08)
Ovarian carcinoma is the most lethal gynaecological malignancy. Better understanding of the molecular pathogenesis of this disease and effective targeted therapies are needed to improve patient outcomes. MicroRNAs play important roles in cancer progression and have the potential for use...

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico