Merck
Todas las fotos(1)

EMU053941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Itgae

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTGGACCACTACAAGGAACCCTCTGCCATCTTCCAGCTGCCCTACGAGAAGGACTGCAAGAACAAAGTGTTCTGCATCGCTGAGATCCAGCTGACCACCAACATCTCCCAGCAGGAACTGGTGGTGGGCGTCACAAAGGAGGTGACCATGAACATCAGCCTGACTAACTCTGGAGAGGATTCCTACATGACAAACATGGCTCTCAATTATCCCAGAAACTTACAGTTTAAGAAGATACAAAAGCCAGTATCTCCAGATGTTCAGTGTGATGACCCCAAGCCAGTTGCTTCTGTCCTGGTCATGAACTGCAAGATTGGTCACCCCATACTCAAGAGATCATCTGTGAATGTCTCAGTAACTTGGCAGCTAGAGGAGAGTGTCTTTCCAAATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAGAGACACGCAGCCTTCAAT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Introduzca el número de lote para buscar un certificado de análisis (COA).

Certificado de origen

Introduzca el número de lote para buscar un Certificado de origen (COO).

Verena Moosbrugger-Martinz et al.
Journal of cellular and molecular medicine, 20(5), 930-938 (2016-03-05)
Atopic dermatitis (AD) is a widespread inflammatory skin disease with an early onset, characterized by pruritus, eczematous lesions and skin dryness. This chronic relapsing disease is believed to be primarily a result of a defective epidermal barrier function associated with
Jayashree Dolpady et al.
Journal of diabetes research, 2016, 7569431-7569431 (2016-01-19)
The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D) via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico