Merck
Todas las fotos(1)

EMU064131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Glul

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAGGAGAAGAAGGGCTACTTTGAAGACCGTCGGCCTTCTGCCAATTGTGACCCCTATGCGGTGACAGAAGCCATCGTCCGCACGTGTCTCCTCAACGAAACAGGCGACGAACCCTTCCAATACAAGAACTAAGTGGACTAGACTTCCAGTGATCCCTCTCCCAGCTCTTCCCTTTCCCAGTTGTCCCCACTGTAACTCAAAAGGATGGAATACCAAGGTCTTTTTATTCCTCGTGCCCAGTTAATCTTGCTTTTGTTGGTCAGAATAGAGGGGTCAGGTTCTTAATCTCTACACACCAACCCTTTCTTTCCTATCTAGCTTTCTAGTGGGGAGCGGGAGGGGGGAGGGGAAGGGTAACCCACTGCTTCATCTCATCGGGTATGCATGTCCGGTAGGCATAGCTGTCACA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Introduzca el número de lote para buscar un certificado de análisis (COA).

Certificado de origen

Introduzca el número de lote para buscar un Certificado de origen (COO).

Vitaliy Marchenko et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 308(11), R916-R926 (2015-04-03)
While supraspinal mechanisms underlying respiratory pattern formation are well characterized, the contribution of spinal circuitry to the same remains poorly understood. In this study, we tested the hypothesis that intraspinal GABAergic circuits are involved in shaping phrenic motor output. To
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico