EHU056051

Sigma-Aldrich

MISSION® esiRNA

targeting human SPTA1

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGTTGCCTCTGAAGGACTGTTTCACAGTCACAAGGGACTTGAGAGAAATCTTGCTGTCATGAGTGACAAGGTGAAGGAGTTATGTGCTAAAGCAGAGAAGCTGACACTTTCCCATCCTTCAGATGCACCTCAGATCCAGGAGATGAAAGAAGATCTGGTCTCCAGCTGGGAGCATATTCGTGCCCTGGCCACCAGCAGATATGAAAAACTGCAGGCTACTTATTGGTACCATCGATTTTCATCTGACTTTGATGAACTCTCAGGCTGGATGAACGAGAAGACTGCTGCGATCAATGCTGATGAGCTGCCAACAGATGTGGCTGGTGGAGAAGTTCTGCTGGACAGGCATCAGCAGCATAAGCATGAGATTGACTCTTACGATGACCGATTTCAATCTGCTGATGAGACTGGTCAAGACCTCGTGAATGCCAATCATGAAGCCTC

N° d'accession Ensembl | humain

N° d'accession NCBI

Expédié(e)(s) dans

ambient

Temp. de stockage

−20°C

Gene Information

human ... SPTA1(6708), SPTA1(6708)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Certificat d'analyse
Certificat d'origine
Evgeny V Berdyshev et al.
PloS one, 6(1), e16571-e16571 (2011-02-10)
Earlier we have shown that extracellular sphingosine-1-phosphate (S1P) induces migration of human pulmonary artery endothelial cells (HPAECs) through the activation of S1P(1) receptor, PKCε, and PLD2-PKCζ-Rac1 signaling cascade. As endothelial cells generate intracellular S1P, here we have investigated the role...
T H Beckham et al.
Oncogenesis, 2, e49-e49 (2013-06-05)
Acid ceramidase (AC) is overexpressed in most prostate tumors and confers oncogenic phenotypes to prostate cancer cells. AC modulates the cellular balance between ceramide, sphingosine and sphingosine 1-phosphate (S1P). These bioactive sphingolipids have diverse, powerful and often oppositional impacts on...
N C Hait et al.
Oncogenesis, 4, e156-e156 (2015-06-09)
Estrogen receptor-α (ERα)-negative breast cancer is clinically aggressive and does not respond to conventional hormonal therapies. Strategies that lead to re-expression of ERα could sensitize ERα-negative breast cancers to selective ER modulators. FTY720 (fingolimod, Gilenya), a sphingosine analog, is the...
Yunze Xu et al.
Oncotarget, 7(3), 3233-3244 (2015-12-18)
Adrenocortical carcinoma (ACC) is a rare endocrine tumor with a very poor prognosis. Sphingosine kinase 1 (SphK1), an oncogenic kinase, has previously been found to be upregulated in various cancers. However, the role of the SphK1 in ACC has not...
Panfeng Fu et al.
The Journal of biological chemistry, 291(53), 27187-27203 (2016-11-20)
Hepatocyte growth factor (HGF) signaling via c-Met is known to promote endothelial cell motility and angiogenesis. We have previously reported that HGF stimulates lamellipodia formation and motility of human lung microvascular endothelial cells (HLMVECs) via PI3K/Akt signal transduction and reactive...

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.