EHU081441

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK14

NACRES:
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT

N° d'accession Ensembl | humain

N° d'accession NCBI

Expédié(e)(s) dans

ambient

Temp. de stockage

−20°C

Gene Information

human ... MAPK14(1432), MAPK14(1432)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Certificat d'analyse
Certificat d'origine
Wan-Juan Song et al.
Pathology, research and practice, 213(10), 1282-1288 (2017-09-17)
This study was to identify the biomarkers for the malignancy and poor prognosis in patients with ovarian cancer. The protein expression of p38MAPK family isoform p38α (p38α) and activating transcription factor 2 (ATF2) was measured in 120 ovarian serous adenocarcinomas...
Yumei Yan et al.
Scientific reports, 6, 37052-37052 (2016-11-16)
Hepatocellular carcinoma (HCC) is refractory to chemotherapies, necessitating novel effective agents. The lysosome inhibitor Bafilomycin A1 (BafA1) at high concentrations displays cytotoxicity in a variety of cancers. Here we show that BafA1 at nanomolar concentrations suppresses HCC cell growth in...
Junlong Liu et al.
Cancer medicine, 9(3), 1183-1195 (2019-12-20)
Mitogen-activated protein kinase 14 (MAPK14), which plays an important role in DNA damage and repair, is activated by various environmental stress and proinflammatory cytokines. It is highly active in a variety of tumors, acting as a tumor promoter or suppressor...
Yu Wang et al.
Oncology reports, 39(1), 61-70 (2017-11-09)
Photodynamic therapy (PDT) is considered to be an advancing antitumor technology. PDT using hydrophilic/lipophilic tetra‑α-(4-carboxyphenoxy) phthalocyanine zinc (TαPcZn-PDT) has exhibited antitumor activity in Bel-7402 hepatocellular cancer cells. However, the manner in which p38 MAPK and caspase-9 are involved in the regulation...
Y Kim et al.
The British journal of dermatology, 179(3), 689-701 (2018-02-28)
Adiponectin is an adipocyte-derived cytokine that circulates as a full-length protein and a fragment containing the globular domain of adiponectin (gAd). A recent study has reported the antimelanogenic effects of full-length adiponectin. To examine the involvement of gAd in melanogenesis...

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.