EHU119111

Sigma-Aldrich

MISSION® esiRNA

targeting human SF3A1

NACRES:
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCCACAGAAGAAGAAGCATCTTCAAAGGAGGATTCTGCACCTTCTAAGCCAGTTGTGGGGATTATTTACCCTCCTCCAGAGGTCAGAAATATTGTTGACAAGACTGCCAGCTTTGTGGCCAGAAACGGGCCTGAATTTGAAGCTAGGATCCGACAGAACGAGATCAACAACCCCAAGTTCAACTTTCTGAACCCCAATGACCCTTACCATGCCTACTACCGCCACAAGGTCAGCGAGTTCAAGGAAGGGAAGGCTCAGGAGCCGTCCGCCGCCATCCCCAAGGTCATGCAGCAGCAGCAGCAGACCACCCAGCAGCAGCTGCCCCAGAAGGTCCAAGCCCAAGTAATCCAAGAGACCATCGTGCCCAAAGAGCCTCCTCCTGAGTTTGAGTTCATTGCTGATCCTCCCTCTATCTCAGCCTTCGACTTGGA

N° d'accession Ensembl | humain

N° d'accession NCBI

Expédié(e)(s) dans

ambient

Temp. de stockage

−20°C

Gene Information

human ... SF3A1(10291), SF3A1(10291)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Certificat d'analyse
Certificat d'origine

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.