EHU121641

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD7

NACRES:
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGCCTGCTACTTCTACGAGCAGGCCTTCCGCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCCCGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGATGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTGACCTGGAAGTGAGAAGTTCTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACCTGGGTG

N° d'accession Ensembl | humain

N° d'accession NCBI

Expédié(e)(s) dans

ambient

Temp. de stockage

−20°C

Gene Information

human ... FZD7(8324), FZD7(8324)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Certificat d'analyse
Certificat d'origine
Yan Geng et al.
Oncology reports, 35(4), 2441-2450 (2016-01-20)
MicroRNAs (miRNAs) are novel tools for cancer therapy. Frizzled7 (FZD7) is an important co-receptor in the WNT signaling pathway. The WNT signaling pathway is aberrantly activated in Helicobacter pylori (H. pylori)‑infected gastric cancer cells. However, the role of FZD7 in...
M Asad et al.
Cell death & disease, 5, e1346-e1346 (2014-07-18)
Ovarian cancer (OC) can be classified into five biologically distinct molecular subgroups: epithelial-A (Epi-A), Epi-B, mesenchymal (Mes), Stem-A and Stem-B. Among them, Stem-A expresses genes relating to stemness and is correlated with poor clinical prognosis. In this study, we show...
Yufeng Wang et al.
Cell death & disease, 9(9), 851-851 (2018-08-30)
Previous evidences reveal that long non-coding RNA (lncRNA) down syndrome critical region 8 (DSCR8) involves in the progression of multiple cancers. However, the exact expression, function, and mechanism of DSCR8 in hepatocellular carcinoma (HCC) remain uncovered. In this study, real-time...
Salvatore Condello et al.
Cancer research, 78(11), 2990-3001 (2018-03-08)
Cancer progression and recurrence are linked to a rare population of cancer stem cells (CSC). Here, we hypothesized that interactions with the extracellular matrix drive CSC proliferation and tumor-initiating capacity and investigated the functions of scaffold protein tissue transglutaminase (TG2)...
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia...

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.