Please see Appendix 1 and 2 in the linked product bulletin below for molecular weight calculations and resuspension guidance.
EHUEGFP
MISSION® esiRNA
targeting EGFP
Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
| Conditionnement | Référence | Disponibilité | Prix |
|---|---|---|---|
| 20 μg | Vérifier la disponibilité des articles du panier | 212,00 € | |
| 50 μg | Vérifier la disponibilité des articles du panier | 378,00 € |
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
212,00 €
Vérifier la disponibilité des articles du panier
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
shipped in
ambient
storage temp.
−20°C
General description
EHUEGFP targets enhanced Green Fluorescent Protein (i.e. eGFP). It can be used as a negative control in systems lacking eGFP, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Other Notes
esiRNA cDNA target sequence: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
1 of 1
Cet article | |||
|---|---|---|---|
| product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
| form lyophilized powder | form lyophilized powder | form lyophilized powder | form lyophilized powder |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech | description Powered by Eupheria Biotech |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level 100 |
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Lin Zhou et al.
Zygote (Cambridge, England), 24(1), 89-97 (2015-02-13)
ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex
Ryan T Gibson et al.
Pathogens (Basel, Switzerland), 9(10) (2020-10-01)
The multi-subunit structural maintenance of chromosomes (SMC) 5/6 complex includes SMC6 and non-SMC element (NSE)3. SMC5/6 is essential for homologous recombination DNA repair and functions as an antiviral factor during hepatitis B (HBV) and herpes simplex-1 (HSV-1) viral infections. Intriguingly
Shalaka Chitale et al.
Nucleic acids research, 45(10), 5901-5912 (2017-04-13)
Repair of damaged DNA relies on the recruitment of DNA repair factors in a well orchestrated manner. As a prerequisite, the chromatin needs to be decondensed by chromatin remodelers to allow for binding of repair factors and for DNA repair
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHUEGFP-50UG | 04061831376647 |
| EHUEGFP-20UG | 04061831367959 |
-
Buongiorno, dove posso trovare il datasheet del prodotto? In particolare, mi interesserebbe sapere il volume di risospensione/il peso molecolare in modo da potermi settare la trasfezione usando le picomoli dxi siRNA/target cell. Grazie
1 réponse-
Utile ?
-