HLTUD0022

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Human

hsa-let-7i-3p

Synonyme(s):
Tough Decoy, hsa-let-7i*, TuD
NACRES:
NA.51

Niveau de qualité

200

Gamme de produits

MISSION®

Concentration

≥1x106 VP/ml (via p24 assay)

Application(s)

capture ELISA: 106 TU/mL using p24 (Volume 200 uL)

Séquence mature

CUGCGCAAGCUACUGCCUUGCU

N° d'accession Sanger mature/mineur

N° d'accession Sanger microARN

Expédié(e)(s) dans

dry ice

Temp. de stockage

−70°C

Description générale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Autres remarques

Based on miRBase V19 Mature ID

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

UN 3245 9

WGK Allemagne

WGK 3

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.