HMI0822

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-597

NACRES:
NA.51

Niveau de qualité

100

Gamme de produits

MISSION®

Séquence mature

UGUGUCACUCGAUGACCACUGU

N° d'accession Sanger mature/mineur

N° d'accession Sanger microARN

Temp. de stockage

−20°C

Gene Information

human ... hsa-miR-597(693182)

Description générale

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Informations légales

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RID ADR

NONH for all modes of transport

WGK Allemagne

WGK 3

Flash Point(F)

Not applicable

Point d'éclair C

Not applicable

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique

Réseaux sociaux

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Recherche. Développement. Production

Nous sommes un des tout premiers fournisseurs du secteur mondial des Sciences de la vie proposant des solutions et des services pour la recherche, le développement et la production en biotechnologies, et le développement et la production de produits thérapeutiques pharmaceutiques.

© 2021 Merck KGaA, Darmstadt, Allemagne et/ou ses sociétés affiliées. Tous droits réservés.

La reproduction d'une quelconque partie du contenu de ce site est strictement interdite sans autorisation.