Merck
  • EHU222311
All Photos(1)

EHU222311

Sigma-Aldrich

MISSION® esiRNA

targeting human SYCE3

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCTGACCCTGAGGAAAGAAACTATGACAACATGCTGAAAATGCTGTCAGATCTGAATAAGGACTTGGAAAAGCTATTAGAAGAGATGGAGAAAATCTCAGTGCAGGCGACCTGGATGGCCTATGACATGGTGGTGATGCGCACCAACCCTACGCTGGCCGAGTCCATGCGTCGGCTGGAGGATGCCTTCGTCAACTGCAAGGAGGAGATGGAGAAGAACTGGCAAGAGCTGCTGCATGAGACCAAGCAAAGGCTGTAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

1 of 4

This Item
EHU020951EMU043561EMU043471
MISSION® esiRNA targeting human SYCE3

Sigma-Aldrich

EHU222311

MISSION® esiRNA

MISSION® esiRNA targeting human PSMA3

Sigma-Aldrich

EHU020951

MISSION® esiRNA

MISSION® esiRNA targeting mouse Snx17

Sigma-Aldrich

EMU043561

MISSION® esiRNA

MISSION® esiRNA targeting mouse Rbm47

Sigma-Aldrich

EMU043471

MISSION® esiRNA

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

ATGCTGACCCTGAGGAAAGAAACTATGACAACATGCTGAAAATGCTGTCAGATCTGAATAAGGACTTGGAAAAGCTATTAGAAGAGATGGAGAAAATCTCAGTGCAGGCGACCTGGATGGCCTATGACATGGTGGTGATGCGCACCAACCCTACGCTGGCCGAGTCCATGCGTCGGCTGGAGGATGCCTTCGTCAACTGCAAGGAGGAGATGGAGAAGAACTGGCAAGAGCTGCTGCATGAGACCAAGCAAAGGCTGTAGG

esiRNA cDNA target sequence

TGGCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGGTCTTACAGTGTGAATGACGGTGCGCAACTCTACATGATTGACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAGCTTCAGATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGTTGCAAAAATAATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGG

esiRNA cDNA target sequence

CAACAGGAGACCCAACAGGTGCCCACAGAGGAGGTTTCCTTGGAAGTGCTGCTCAGCAATGGACAGAAAGTTCTGGTAACTGTGCTAACTTCTGACCAGACAGAAGATGTCCTGGAGGCTGTGGCTGCAAAGCTGGATCTTCCAGATGACTTGATCGGATATTTTAGTCTCTTCCTTGTTCGAGAAAAAGAAGATGGAGCCTTTTCTTTTGTACGGAAGCTGCAGGAGTTTGAACTGCCTTATGTATCTGTTACCAGTCTTCGGAGTCAAGAGTATAAGATTGTGCTCAGAAAGAGTTATTGGGACTCTGCCTATGACGACGATGTCATGGAGAACCGGGTTGGCCTGAACCTGCTTTATGCTCAGACGGTGTCAGACATTGAGCATGGCTGGATCCTGGTCACCAAAGAGCAGCACCGGCAGCTCAAATCTCTGCAAGAGAAGGTCTCCAAAAAGGAGTTCTTGCGGCTGGCCCAAACTCTGCGGCACTATGGCTATCTGCGCTTTGATGCCTGTGTGGCTGACTTTCCAGAGAAGGATTGCCCTGTTGTG

esiRNA cDNA target sequence

AAGAGCTTTGGCCAGTTCAACCCAGGCTGCGTGGAAAGGGTCAAGAAGATCCGTGACTACGCCTTCGTGCACTTCACTAGCCGTGAGGATGCTGTGCATGCTATGAACAACCTCAACGGCACAGAGCTGGAGGGATCCTGCTTAGAAGTCACGCTGGCCAAGCCCGTGGACAAGGAACAGTACTCCCGCTACCAGAAGGCAGCCAAGGGTGGTGGTGGCTCGGCTGAGGCCGTAGCGCAGCAACCCAGCTACGTGTACTCCTGTGACCCCTACACGTTGGCCTACTACGGCTACCCCTACAACGCTCTCATCGGGCCCAACCGGGACTACTTCGTGAAAACAGGCAGCATAAGAGGCCGAGGGAGAGGCGCAGCTGGAAACAGGACCCCAGGGCCCAGGGGTTCCTACCTCGGAGGATATTCCGCTGGCCGTGGTATATATAGCCGATATCACGAAGGCAAAGGCAAACAGCAGGAGAAAGGATATGAACTTGTGCCGAATTTGGAGATCTCTCCTGTCAATCCAGTTGCCATTAAACCTGGCACAGTGGC

Ensembl | human accession no.

ENSG00000217442

Ensembl | human accession no.

ENSG00000100567

Ensembl | human accession no.

NM_153680

Ensembl | human accession no.

NP_001120854

NCBI accession no.

ENSG00000217442

NCBI accession no.

ENSG00000100567

NCBI accession no.

NM_153680

NCBI accession no.

NP_001120854

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service