EHU000461

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC7A4

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCTGGCCTACACATTCGTGGCCACCAGTATCATTGTGCTGCGCTTCCAGAAGTCTTCCCCGCCCAGCTCCCCAGGCCCAGCCAGCCCTGGCCCCCTGACCAAGCAGCAGAGCTCCTTCTCAGACCACCTACAGCTGGTGGGCACTGTACACGCCTCCGTCCCTGAGCCAGGGGAGCTGAAGCCAGCCCTGAGGCCCTACCTGGGCTTCTTGGATGGGTACAGCCCTGGAGCAGTGGTGACTTGGGCGCTTGGCGTTATGTTGGCCTCAGCCATCACCATAGGCTGCGTGCTTGTCTTTGGGAACTCGACCCTGCACCTCCCACACTGGGGTTACATCCTGCTGCTCCTGCTCACCAGTGTCATGTTTCTGCTCAGCCTCCTTGTCCTGGGGGCTCACCAGCAACAGTATCGGGAAGACTTATTTCAGATCCCCATGGTTCCCCTGATTCCAGCCCTGAGCATCGTCCTCAACATCTGCCTCATGCTGAAACTTAGCTATCTGACCTGGGTGCGCTTCTCCATCTGGCTGCTGATGGGACTTGCAGTGTATTTCGGCTATGGCATCCGGCATAGCAAGGAGAACCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC7A4(6545), SLC7A4(6545)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point F

Not applicable

Flash Point C

Not applicable

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico

Redes sociales

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Investigación. Desarrollo. Producción.

Somos un proveedor líder para la industria de Ciencias de la Vida con soluciones y servicios para investigación, desarrollo y producción biotecnológicos, y para desarrollo y producción de tratamientos farmacéuticos

© 2021 Merck KGaA, Darmstadt, Alemania y/o sus filiales. Todos los derechos reservados.

Queda estrictamente prohibida la reproducción sin permiso de cualquiera de los materiales de la página web.