EHU003861

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1A

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDKN1A(1026), CDKN1A(1026)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point F

Not applicable

Flash Point C

Not applicable

Yi Ji et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 895-907 (2016-12-13)
The Notch signaling pathway has been implicated in the pericyte phenotype, but its exact roles in hemangioma-derived pericytes (Hem-pericytes) remain ill defined. Hem-pericytes were stimulated by immobilized recombinant Jagged1. The potential mechanisms of Notch-induced Hem-pericytes growth arrest were investigated by...
Mugdha Patki et al.
Scientific reports, 8(1), 16006-16006 (2018-10-31)
Dexamethasone (Dex), co-administered to lung adenocarcinoma patients with pemetrexed chemotherapy, protects against pemetrexed cytotoxicity by inducing reversible G1 arrest, reflected by the effect of Dex on FLT-PET images of patient tumors. However, perioperative Dex treatment increases survival but the mechanism...
Hui Zhu et al.
Stem cells (Dayton, Ohio), 32(8), 2098-2110 (2014-04-18)
In mammalian embryos, embryonic stem cells (ESCs) and induced pluripotent cells, a shortened G1 phase is correlated with the pluripotent state. To molecularly define this phase, we compared transcripts from the shortened G1 of human ESCs (hESCs) with those from...
Outhiriaradjou Benard et al.
Molecular cancer research : MCR, 17(7), 1571-1581 (2019-04-11)
Cancer stem cells (CSC) generate and sustain tumors due to tumor-initiating potential, resulting in recurrence or metastasis. We showed that knockout of the cell-cycle inhibitor, p21CIP1, in the PyMT mammary tumor model inhibits metastasis; however the mechanism remained unknown. Here...
Hang Thi Thuy Bui et al.
International journal of medical sciences, 16(11), 1412-1423 (2019-11-02)
Resistance against tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced cell death of cancer cells is a major obstacle in clinical application of TRAIL. Variable response to TRAIL of gastric cancer cells, synergy of TRAIL with bortezomib and potential mechanisms behind the...

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico

Redes sociales

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Investigación. Desarrollo. Producción.

Somos un proveedor líder para la industria de Ciencias de la Vida con soluciones y servicios para investigación, desarrollo y producción biotecnológicos, y para desarrollo y producción de tratamientos farmacéuticos

© 2021 Merck KGaA, Darmstadt, Alemania y/o sus filiales. Todos los derechos reservados.

Queda estrictamente prohibida la reproducción sin permiso de cualquiera de los materiales de la página web.