EHU006461

Sigma-Aldrich

MISSION® esiRNA

targeting human FLCN

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGCCTGAGCAAGACCTACAAGTCACACCTCATGTCCACGGTCCGCAGCCCCACAGCCTCGGAGTCTCGGAACTGACCCGTCACACACACCTGCCTAAAGACAGGGATGGCTGTCCACAGGATCCTCCAGCCCCGTGAGAGGGACTGTCCCTTGAGTTTCTCAACTGCTGGAAGGAGCTGTGTCCCAGCAAGGAAGGGAAACCATCAGGGCTGGGCTCGGCCCTGTCAGGTTTGGGGCCTGTGTGCTTCCCAGACTCTCCCTCCAGCCGTTGGAATCGCTGAAGATGGCAATGAAAGGCGGAGGGATGATGGGCTCTCTCTGTGTTCAAACTCCTTGGAGAGACGACTAGGAGGACAGCTTGCCTCCCAGGCCCCTTGTGGACTTAGACTCAAAACCCGCAGGAGAAACAGGTCCGACTCAGTATGCAGTCGCAATAACATGTCTGCTCCCGAGGTTAACATTCAAGCGTTTCTACTTTGAAATTCAGCAAGAGTTTCTGGGCCTTATGTTTGAGGGTACCTTTTGCTGCAGTTGTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FLCN(201163), FLCN(201163)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point F

Not applicable

Flash Point C

Not applicable

Malte P Bartram et al.
BMC medical genetics, 18(1), 53-53 (2017-05-14)
Renal cell carcinoma is among the most prevalent malignancies. It is generally sporadic. However, genetic studies of rare familial forms have led to the identification of mutations in causative genes such as VHL and FLCN. Mutations in the FLCN gene...
Seung-Beom Hong et al.
PloS one, 5(12), e15793-e15793 (2011-01-07)
Germline mutations in a tumor suppressor gene FLCN lead to development of fibrofolliculomas, lung cysts and renal cell carcinoma (RCC) in Birt-Hogg-Dubé syndrome. TFE3 is a member of the MiTF/TFE transcription factor family and Xp11.2 translocations found in sporadic RCC...
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and...

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico

Redes sociales

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Investigación. Desarrollo. Producción.

Somos un proveedor líder para la industria de Ciencias de la Vida con soluciones y servicios para investigación, desarrollo y producción biotecnológicos, y para desarrollo y producción de tratamientos farmacéuticos

© 2021 Merck KGaA, Darmstadt, Alemania y/o sus filiales. Todos los derechos reservados.

Queda estrictamente prohibida la reproducción sin permiso de cualquiera de los materiales de la página web.