Todas las fotos(1)

EHU006671

Sigma-Aldrich

MISSION® esiRNA

targeting human RNMT

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTGACATGATGCTGAGAAATGCGTGTGAGAGACTTAGCCCTGGGGGCTATTTTATTGGTACTACTCCCAATAGCTTTGAATTGATAAGACGCCTTGAAGCTTCAGAAACAGAATCATTTGGAAATGAAATATATACTGTGAAATTTCAGAAGAAAGGAGATTATCCTTTATTTGGCTGCAAATATGACTTCAACTTGGAAGGTGTTGTGGATGTTCCTGAATTCTTGGTCTATTTTCCATTGCTAAATGAAATGGCAAAGAAGTACAATATGAAACTAGTCTACAAAAAAACATTTCTGGAATTCTACGAAGAAAAGATTAAGAACAATGAAAATAAAATGCTCTTAAAACGAATGCAGGCCTTGGAGCCATATCCTGCAAATGAGAGTTCTAAACTTGTCTCTGAGAAGGTGGATGACTATGAACATGCAGCAAAGTACATGAAGAACAGTCAAGTAAGGTTACCTTTGGGAACCTTAAGTAAATCAGAATGGGAAGCTACAAGTATTTACTTGGTGTTTGCCTTTGAGAAACAGCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Certificado de origen

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico