Todas las fotos(1)

EHU008211

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC4

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGCCCTAGTGAACTGTCAATATAGTTCAGCGACCTTCAGCACAGGTGAGCGCAAGCGACGGCCACATGGGGACCGTAAGTCCTGTGAGATGGGCCTGCAGCTCCGCCAGACTTTCGAAGCAGCCATCCTCACACAGCTGCACCCACGCTCCCAGATTGATATCTATGTGCAGGTGCTACAGGCAGATGGTGGGACCTATGCAGCTTGTGTGAATGCAGCCACGCTGGCAGTGCTGGATGCCGGGATACCCATGAGAGACTTTGTGTGTGCGTGCTCAGCTGGCTTCGTGGACGGCACAGCCCTGGCGGACCTCAGCCATGTGGAGGAAGCAGCTGGTGGCCCCCAGCTGGCCCTGGCCCTGCTGCCAGCCTCAGGACAGATTGCGCTGCTTGAGATGGATGCCCGGCTGCACGAGGACCACCTGGAGCGGGTGTTGGAGGCTGCTGCCCAGGCTGCCCGAGATGTGCACACCCTCTTAGATCGAGTGGTCCGGCAGCATGTGCGTGAGGCCTCTATCTTGCTGGGGGACTGAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Certificado de origen

Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico