Merck
Todas las fotos(1)

EHU079771

Sigma-Aldrich

MISSION® esiRNA

targeting human PFKFB2

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

línea de producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACGACTTCTTTCGGCATGACAATGAGGAGGCCATGAAGATCCGCAAACAGTGTGCTCTGGTGGCGCTGGAAGATGTTAAGGCGTATCTCACTGAGGAGAATGGTCAGATTGCGGTGTTTGATGCCACCAATACAACCCGGGAGAGGAGGGACATGATTTTGAACTTTGCTGAACAGAATTCCTTCAAGGTATTCTTTGTGGAATCCGTCTGTGATGATCCTGATGTCATTGCTGCCAATATTCTGGAGGTTAAGGTATCAAGCCCTGACTATCCTGAAAGGAACAGAGAGAACGTGATGGAGGACTTCCTGAAGAGAATTGAATGCTACAAAGTTACCTACCGACCTCTTGACCCAGACAACTATGACAAGGATCTTTCTTTCATCAAGGTGATAAACGTGGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

enviado en

ambient

temp. de almacenamiento

−20°C

Gene Information

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad F

Not applicable

Punto de inflamabilidad C

Not applicable

Certificado de Análisis

Introduzca el número de lote para buscar un certificado de análisis (COA).

Certificado de origen

Introduzca el número de lote para buscar un Certificado de origen (COO).

In-Kyu Kim et al.
Cell death and differentiation, 27(7), 2263-2279 (2020-02-09)
The pathogenesis of thymic epithelial tumors (TETs) is poorly understood. Recently we reported the frequent occurrence of a missense mutation in the GTF2I gene in TETs and hypothesized that GTF2I mutation might contribute to thymic tumorigenesis. Expression of mutant TFII-I

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico