EHU134631

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1H3

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point F

Not applicable

Flash Point C

Not applicable

Certificado de Análisis

Certificado de origen

Akihiro Shimada et al.
Lipids in health and disease, 15, 57-57 (2016-03-18)
Statins decrease cholesteryl ester transfer protein (CETP) levels, which have been positively associated with hepatic lipid content as well as serum low density lipoproteins-cholesterol (LDL-C) levels. However, the relationship between the CETP status and statin-induced reductions in LDL-C levels has...
Claudia Bellomo et al.
Cell death and differentiation, 25(5), 885-903 (2017-12-13)
Understanding the complexity of changes in differentiation and cell survival in hepatocellular carcinoma (HCC) is essential for the design of new diagnostic tools and therapeutic modalities. In this context, we have analyzed the crosstalk between transforming growth factor β (TGFβ)...
Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed...
Louise Ménégaut et al.
Cell reports, 31(7), 107665-107665 (2020-05-21)
Low-grade inflammation is constitutive of atherosclerosis, and anti-inflammatory therapy inhibiting interleukin-1β (IL-1β) reduces the rate of cardiovascular events. While cholesterol accumulation in atheroma plaque and macrophages is a major driver of the inflammatory process, the role of the LXR cholesterol...
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported...

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico

Redes sociales

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Investigación. Desarrollo. Producción.

Somos un proveedor líder para la industria de Ciencias de la Vida con soluciones y servicios para investigación, desarrollo y producción biotecnológicos, y para desarrollo y producción de tratamientos farmacéuticos

© 2021 Merck KGaA, Darmstadt, Alemania y/o sus filiales. Todos los derechos reservados.

Queda estrictamente prohibida la reproducción sin permiso de cualquiera de los materiales de la página web.