opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAACGTGCCTCGGGTACTAAATTCAGCTAAGGAGAAATCAAGCACTGTTCCAATACCTACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTATCCCAGGAATCCCACTGTAAGATGGGGTTATGTCGCTATGAAGTTTGCACAGGTCTTTGGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCTTGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTCCTATGTGTATTTAACTCCATCTTGCCAGGTGTGCTGATTCTCTTCCTTACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTTGCTGAGATGTTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACGTCATACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGGCTATATTACTATGCTTACAAGGACTTTCTCTGGTTTTTCTCCAAGAGATTCAAATCTGCTGCCATGTTAGCTGTCTTTGCTGTATCTGCTGTAGTACACGAATATGCCTTGGCTGTTT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... SOAT1(6646), SOAT1(6646)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Yu Xu et al.
Theranostics, 10(24), 11302-11323 (2020-10-13)
Background: Activation of the thermogenic program in white and brown adipocytes presents a promising avenue for increasing energy expenditure during the treatment of obesity. The endogenous mechanism for promoting thermogenesis in brown adipocytes or browning in white adipocytes has indicated...
Zhaoe Liu et al.
DNA and cell biology, 35(11), 730-739 (2016-11-01)
Pycnogenol
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls...
Feng Geng et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5337-5348 (2016-11-03)
Elevated lipogenesis regulated by sterol regulatory element-binding protein-1 (SREBP-1), a transcription factor playing a central role in lipid metabolism, is a novel characteristic of glioblastoma (GBM). The aim of this study was to identify effective approaches to suppress GBM growth...
Wataru Amano et al.
The Journal of allergy and clinical immunology, 136(3), 667-677 (2015-06-28)
Barrier disruption and the resulting continuous exposure to allergens are presumed to be responsible for the development of atopic dermatitis (AD). However, the mechanism through which skin barrier function is disrupted in patients with AD remains unclear. Taking into account...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.