opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCACCAAACTTCCCTGTGTTTGTGATCTTCCGCTTCCTGCAAGGTGTATTTGGAAAGGGGACGTGGATGACTTGCTACGTGATTGTGACAGAAATAGTAGGTTCGAAACAAAGGAGGATTGTGGGAATCGTGATTCAAATGTTCTTTACCCTTGGAATCATAATTCTCCCTGGAATTGCCTACTTCATCCCCAACTGGCAAGGAATCCAGTTAGCCATCACGCTGCCCAGCTTTCTCTTCCTCCTTTATTACTGGGTGGTCCCTGAGTCTCCCCGTTGGCTGATTACTCGGAAGAAAGGAGATAAAGCATTACAGATCCTGAGACGCATTGCTAAGTGCAATGGGAAATACCTCTCATCAAATTACTCAGAGATCACTGTTACAGATGAGGAAGTTAGTAATCCATCCTTTTTAGATCTGGTGAGAACTCCCCAAATGAGG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... SLC22A3(6581), SLC22A3(6581)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Ji-Xian Xiong et al.
International journal of biological sciences, 14(12), 1658-1668 (2018-11-13)
Esophageal squamous cell carcinoma (ESCC) occurs with the highest frequency in China, especially in the high-risk Northern Chinese. Recent studies have reported that SLC22A3 is significantly downregulated in non-tumor (NT) esophageal tissues from familial ESCC patients compared with those from...
Cheng-Ming Hsu et al.
Oncotarget, 8(43), 74348-74358 (2017-11-02)
Solute carrier family 22 member 3 (SLC22A3), also called organic cation transporter 3 (OCT3), is responsible for organic cation transport, which can eliminate many endogenous small organic cations, drugs, and toxins. This study investigated whether SLC22A3 expression is related to...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.