opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGACCTTCCAGATCGCTTCCTCTCGCAACAAACTATTTGTCGCAGGAATAAAGATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTTTACTTTATAGATTTAATGTTTATTGTAGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTCCCAGGACATGA

Ensembl | numer dostępu dla gatunku człowiek

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... IL18(3606), IL18(3606)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Rui Sun et al.
Translational oncology, 13(10), 100825-100825 (2020-07-23)
Studies have begun to emerge showing the protumor effects of tumor-associated neutrophils (TANs) in tumorigenesis, which may involve dysfunction of NK cells. However, the mechanism through which these rebellious neutrophils modulate NK cell immunity in tumor-bearing state remains unclear. In...
Amélie Bourdiec et al.
Reproductive biomedicine online, 32(1), 85-95 (2015-11-26)
The mechanisms involving the expression of interleukin (IL) 1 family members in the process of preparing the endometrium to receive an embryo remain unclear. In this study, decidualization differentially skewed the balance of IL1 family receptor expression in a pattern...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.