opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACTCCTGCCCTCTGACTTCAGCCGCTACTTCCAATATGAGGGGTCTCTGACTACACCGCCCTGTGCCCAGGGTGTCATCTGGACTGTGTTTAACCAGACAGTGATGCTGAGTGCTAAGCAGCTCCACACCCTCTCTGACACCCTGTGGGGACCTGGTGACTCTCGGCTACAGCTGAACTTCCGAGCGACGCAGCCTTTGAATGGGCGAGTGATTGAGGCCTCCTTCCCTGCTGGAGTGGACAGCAGTCCTCGGGCTGCTGAGCCAGTCCAGCTGAATTCCTGCCTGGCTGCTGGTGACATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCAGCACAGAAGGGGAACCAAAGGGGGTGTGAGCTACCGCCCAGCAGAGGTAGCCGAGACTGGAGCCTAGAGGCTGGATCTTGGAGAATGTGAGAAGCCAGC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... CA9(768), CA9(768)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Kuo-Tai Hua et al.
Scientific reports, 7(1), 4466-4466 (2017-07-02)
Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism...
Martin Benej et al.
Frontiers in oncology, 10, 1462-1462 (2020-09-29)
Tumor hypoxia represents a severe microenvironmental stress that is frequently associated with acidosis. Cancer cells respond to these stresses with changes in gene expression that promote survival at least in part through pH regulation and metabolic reprogramming. Hypoxia-induced carbonic anhydrase...
Somayeh Jamali et al.
Scientific reports, 5, 13605-13605 (2015-09-05)
The most aggressive tumour cells, which often reside in hypoxic environments, rely on glycolysis for energy production. Thereby they release vast amounts of lactate and protons via monocarboxylate transporters (MCTs), which exacerbates extracellular acidification and supports the formation of a...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.