Merck
Wszystkie zdjęcia(1)

EHU040811

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX4

NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

forma

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGCTGTGATCGATGGAGAATTTAAGGAGCTGAAGTTAACTGATTATCGTGGGAAATACTTGGTTTTCTTCTTCTACCCACTTGATTTCACATTTGTGTGTCCAACTGAAATTATCGCTTTTGGCGACAGACTTGAAGAATTCAGATCTATAAATACTGAAGTGGTAGCATGCTCTGTTGATTCACAGTTTACCCATTTGGCCTGGATTAATACCCCTCGAAGACAAGGAGGACTTGGGCCAATAAGGATTCCACTTCTTTCAGATTTGACCCATCAGATCTCAAAGGACTATGGTGTATACCTAGAGGACTCAGGCCACACTCTTAGAGGTCTCTTCATTATTGATGACAAAGGAATCCTAAGACAAATTACTCTGAATGATCTTCCTGTGGGTAGATCAGTGGATGAGACACTACGTTTGGTTCAAGCATTCCAGTACACTGACAAACACGGAGAAGTCTGCC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

transport

ambient

temp. przechowywania

−20°C

Gene Information

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Certyfikat analizy

Wprowadź numer partii, aby wyszukać certyfikat analizy (COA).

Świadectwo pochodzenia

Wprowadź numer partii, aby wyszukać świadectwo pochodzenia (COO).

Sun Yi Park et al.
Oncology letters, 19(5), 3522-3530 (2020-04-10)
Peroxiredoxin IV (PRDX4) is a multifunctional protein that is involved in cell protection against oxidative injury, regulation of cell proliferation, modulation of intracellular signaling, and the pathogenesis of tumors. We previously conducted a proteomic analysis to investigate tumor-specific protein expression

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej