opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACACTGCAGCCACGTTAAATTTGCAGATCGCTGGACTTCAAACAAGTGTGAAGAGGCTGTGTGGCGAGATTGTGGAACTGAAGCAGCACCTGGAGCACTACGACAAGATCCAGGAGCTCACGCAGATGCTGCAGGAGAGCCACAGCTCCCTGGTCAGCACCAATGAACACCTGCTGCAGGAGCTGAGCCAGGTGCGGGCGCAGCACAGAGCCGAGGTGGAGCAGATGCACTGGAGCTACCAGGAGCTCAAGAAGACCATGGCCCTGTTTCCACACAGCAGCGCCAGCCATGGAGGCTGCCAGGCCTGCTGACTCCTGCCGAGAAGCTGGGCCACCCCTTAAGCTTCCTGGTAAAGTTACATTGTCTGCACCTTTGTACTTCTTTATTGAGTGTACTGGCTGGCAAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... CEP72(55722), CEP72(55722)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Timothy R Stowe et al.
Molecular biology of the cell, 23(17), 3322-3335 (2012-07-07)
Defects in centrosome and cilium function are associated with phenotypically related syndromes called ciliopathies. Centriolar satellites are centrosome-associated structures, defined by the protein PCM1, that are implicated in centrosomal protein trafficking. We identify Cep72 as a PCM1-interacting protein required for...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.