opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AACTCCTGGAGGTAGCAGCAGCTCCTGCCCCAGAGTGGTGTCCTCTGGCAGCCCAGCCCCAGGCTCTGTGACAGCCTAGTGAGGGCTGCAAGACCATCCTGCCCGGACCACAGAAGGAGAGTTGGCGGTCACAGAGGGCTCCTCTGCCAGGCAGTGGGAAGCCCTGGGTTTGGCCTCAGGAGCTGGGGGTGCAGTGGGGGACTGCCCTAGTCCTTGCCAGGTCGCCAGCACCCTGGAGAAGCATGGGGCGTAGCCAGCTCGGAACTTGCCAGGCCCCAAAGGCCACGACTGCCTGTTGGGGACAGGAGATGCATGGACAGTGTGCTCAAGCTGTGGGCATGTGCTTGCCTGCGGGAGAGGTCCTTCACTGTGTGTACACAGCAAGAGCATGTGTGTGCCACTTC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... RASSF7(8045), RASSF7(8045)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Min Zhang et al.
Cellular and molecular biology (Noisy-le-Grand, France), 64(5), 73-79 (2018-05-08)
The Ras-association domain family (RASSF) proteins have been involved in many important biological processes. RASSF7 is recently reported to be up-regulated in several types of cancer. However, the function of RASSF7 remain unknown in human cancers. To explore the role...
Xiaoying Zheng et al.
Oncotarget, 8(45), 78734-78748 (2017-11-08)
Lung cancer is the leading cause of cancer-related deaths worldwide, and despite recent improvements in treatment patient prognosis remains dismal. In this study, we examined the role of N-terminal Ras-association domain family 7 (RASSF7) in human non-small cell lung cancer...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.