EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Certyfikat analizy

Świadectwo pochodzenia

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However...
Valeria Crippa et al.
Scientific reports, 6, 22827-22827 (2016-03-11)
Neurodegenerative diseases (NDs) are often associated with the presence of misfolded protein inclusions. The chaperone HSPB8 is upregulated in mice, the human brain and muscle structures affected during NDs progression. HSPB8 exerts a potent pro-degradative activity on several misfolded proteins...
Raquel Parra-Millán et al.
mSphere, 3(2) (2018-03-31)
Acinetobacter baumannii is a significant human pathogen associated with hospital-acquired infections. While adhesion, an initial and important step in A. baumannii infection, is well characterized, the intracellular trafficking of this pathogen inside host cells remains poorly studied. Here, we demonstrate that...
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic...
Li He et al.
Journal of leukocyte biology, 100(5), 1113-1124 (2016-11-02)
Macrophage dysfunction in obesity and diabetes is associated with persistent inflammation and poor wound healing responses. Relevant to these phenotypes, we have previously shown that macrophage activation in a high-fat environment results in cell death via a mechanism that involves...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej