opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGAGGCACATTCACCATTAGTACCACTCTCCGGCTGGGTAGACAGATTTTGGAGTCTATTGAAAGCATTCATTCTGTGGGATTCTTGCATCGAGACATCAAACCGTCGAACTTCGCTATGGGTCGCTTTCCTAGTACATGTAGGAAATGTTACATGCTTGATTTTGGCTTGGCTCGACAATTTACCAATTCCTGTGGTGACGTCAGACCACCTCGAGCTGTGGCAGGTTTTCGAGGGACAGTTCGTTATGCATCAATCAACGCACATCGGAACAGGGAAATGGGAAGACATGATGACCTTTGGTCCTTATTCTACATGTTGGTGGAGTTTGTGGTTGGTCAGCTGCCCTGGAGAAAAATAAAGGACAAGGAGCAAGTAGGCTCTATTAAGGAGAGATATGACCACAGGCTCATGTTGAA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... TTBK2(146057), TTBK2(146057)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Mi-Young Lee et al.
Cell division, 9, 3-3 (2014-10-04)
Centrosome amplification (CA) amongst particular breast cancer subtypes (Her2+ subtype) is associated with genomic instability and aggressive tumor phenotypes. However, changes in signaling pathways associated with centrosome biology have not been fully explored in subtype specific models. Novel centrosome regulatory...
Xing Liu et al.
Oncotarget, 6(33), 34309-34320 (2015-09-30)
Hepatocellular carcinoma (HCC) is one of the most malignant cancers with poor clinical outcome. The protein kinase human monopolar spindle 1 (hMps1/TTK) gene expression is significantly increased in HCCs. However, its contributions to hepatocarcinogenesis remain unclear. In this study, we...
Takashi Watanabe et al.
The Journal of cell biology, 210(5), 737-751 (2015-09-02)
Microtubules (MTs) play critical roles in various cellular events, including cell migration. End-binding proteins (EBs) accumulate at the ends of growing MTs and regulate MT end dynamics by recruiting other plus end-tracking proteins (+TIPs). However, how EBs contribute to MT...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.