opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCCATTGTAACCAGGTCATCAGAGGACCATTCTTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGCGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTAGAGGAGAAAGGAGCCCTGTATTGTGAGCTGTGCTATGAGAAATTCTTTGCCCCTGAATGTGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAGTGCGTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTAGCCTGTGGAAAGCCCATTCGGAACAATGTTTTTCACTTGGAGGATGGTGAACCCTACTGTGAGACTGATTATTATGCCCTCTTTGGTACTATATGCCATGGATGTGAATTTCCCATAGAAGCTGGTGACATGTTCCTGGAAGCTCTGGGCTACAC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... PDLIM5(10611), PDLIM5(10611)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Xiaodan Wei et al.
Biochemical and biophysical research communications, 499(2), 338-344 (2018-03-27)
In order to better understand the mechanisms underlying the development of papillary thyroid carcinoma (PTC), and to identify new potential biomarkers, high-resolution label-free mass spectrometry was performed on PTC tissues and adjacent normal thyroid tissues from six patients. In this...
Han Cheng et al.
Journal of biomolecular screening, 21(4), 333-341 (2016-01-15)
Pulmonary arterial hypertension is a complex disease with multiple etiologic factors. PDLIM5, a member of the Enigma subfamily of PDZ and LIM domain protein family, contains an N-terminal PDZ domain and three LIM domains at its C-terminus. We have previously...
Yong Lu et al.
Psychoneuroendocrinology, 115, 104629-104629 (2020-03-17)
Prenatal stress (PS) contributes to depression-like behavior in the offspring. PDLIM5 is involved in the onset of mental disorders. This study is to investigate the role and mechanism of PDLIM5 in depression-like behavior of PS offspring rats. PS model was...
Pingbo Xie et al.
Frontiers in genetics, 11, 1030-1030 (2020-10-27)
Prostate cancer remains a significant cause of cancer-related deaths in male population. More recently, accumulating evidence continues to implicate long non-coding RNAs (lncRNAs), microRNAs (miRNAs), and mRNAs in various types of cancers, including prostate cancer. The current study aimed to...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.