opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... CREB1(1385), CREB1(1385)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Supriya Srinivasan et al.
Cancer research, 78(21), 6146-6158 (2018-09-21)
Although smoking is a significant risk factor for pancreatic ductal adenocarcinoma (PDAC), the molecular mechanisms underlying PDAC development and progression in smokers are still unclear. Here, we show the role of cyclic AMP response element-binding protein (CREB) in the pathogenesis...
Hui-Xia Geng et al.
Neurochemical research, 42(10), 2841-2849 (2017-05-17)
Neuronal apoptosis mediated by the mitochondrial apoptosis pathway is an important pathological process in cerebral ischemia-reperfusion injury. 14,15-EET, an intermediate metabolite of arachidonic acid, can promote cell survival during ischemia/reperfusion. However, whether the mitochondrial apoptotic pathway is involved this survival...
L Yuan et al.
Neuropathology and applied neurobiology, 42(7), 607-620 (2015-11-04)
14,15-Epoxyeicosatrienoic acid (14,15-EET) is abundantly expressed in brain and exerts protective effects against ischaemia. 14,15-EET is hydrolysed by soluble epoxide hydrolase (sEH). sEH-/- mice show a higher level of 14,15-EET in the brain. Astrocytes play a pivotal role in neuronal...
Tao Xiao et al.
Stem cells translational medicine, 8(2), 148-161 (2018-11-15)
Fibrous dysplasia (FD) is a disease of postnatal skeletal stem cells caused by activating mutations of guanine nucleotide-binding protein alpha-stimulating activity polypeptide (GNAS). FD is characterized by high proliferation and osteogenesis disorder of bone marrow stromal cells (BMSCs), resulting in...
Xue Zhang et al.
Scientific reports, 7(1), 9968-9968 (2017-09-01)
Mitochondrial dysfunction has been implicated in the pathogenesis of Parkinson's disease (PD) for several decades, and disturbed mitochondrial biogenesis (mitobiogenesis) was recently found to be a common phenomenon in PD. Baicalein, a major bioactive flavone of Scutellaria baicalensis Georgi, exerted...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.