opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCCTTACTACGTGGACCTGAACCAGGACTTGTACGTTCAGGCTGAAATCCTCCATTCTGATGCTGTACTGACCTTGTTTGTGGACACCTGCGTGGCATCACCATACTCCAATGACTTCACGTCTTTGACTTATGATCTAATCCGGAGTGGATGCGTGAGGGATGACACCTACGGACCCTACTCCTCGCCATCTCTTCGCATTGCCCGCTTCCGGTTCAGGGCCTTCCACTTCCTGAACCGCTTCCCCTCCGTGTACCTGCGTTGTAAAATGGTGGTGTGCAGAGCGTATGACCCCTCTTCCCGCTGCTACCGAGGCTGTGTGTTGAG

Ensembl | numer dostępu dla gatunku człowiek

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... DMBT1(1755), DMBT1(1755)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Chao Liang et al.
Nature communications, 10(1), 4579-4579 (2019-10-09)
Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by progressive bone erosion. Leflunomide is originally developed to suppress inflammation via its metabolite A77 1726 to attenuate bone erosion. However, distinctive responsiveness to Leflunomide is observed among RA individuals. Here...
S C Chang et al.
Cell death and differentiation, 21(9), 1388-1398 (2014-05-03)
The checkpoint between the life and death of macrophages is crucial for the host's frontline immune defense during acute phase infection. However, the mechanism as to how the immune cell equilibrates between apoptosis and immune response is unclear. Using in...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.