opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCAACGTGGAGAACCTACCCCCGCACATCATCCGCCTGGTGTACAAGGAGGTGACGACACTGACCGCAGACCCACCCGATGGCATCAAGGTCTTTCCCAACGAGGAGGACCTCACCGACCTCCAGGTCACCATCGAGGGCCCTGAGGGGACCCCATATGCTGGAGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCGAACGTGGGCGCCAATGGCGAGATCTGCGTCAACGTGCTCAAGAGGGACTGGACGGCTGAGCTGGGCATCCGACACGTACTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCCGAGTCTGCACTCAACGAGGAGGCGGGCCGCCTGCTCTTGGAGAACTACGAGGAGTATGCGGCTC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... UBE2S(27338), UBE2S(27338)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Shusaku Yoshimura et al.
Biochemical and biophysical research communications, 485(4), 820-825 (2017-03-05)
Ubiquitin-conjugating enzyme E2S (UBE2S), a family of E2 protein in the ubiquitin-proteasome system, is highly expressed in several types of cancers; however, its roles in oral squamous cell carcinoma (OSCC) have not yet been well elucidated. The purpose of this...
Peng Kuang et al.
Scientific reports, 6, 37441-37441 (2016-12-03)
SAG/RBX2 and RBX1 are two family members of RING components of Cullin-RING ligases (CRLs), required for their enzymatic activity. Previous studies showed that SAG prefers to bind with CUL5, as well as CUL1, whereas RBX1 binds exclusively to CULs1-4. Detailed...
Tsung-Han Lin et al.
Food & function, 8(4), 1558-1568 (2017-03-10)
We previously reported that the dietary flavonoids, luteolin and quercetin, might inhibit the invasiveness of cervical cancer by reversing epithelial-mesenchymal transition (EMT) signaling. However, the regulatory mechanism exerted by luteolin and quercetin is still unclear. This study analyzed the invasiveness...
Raquel C Martinez-Chacin et al.
Nature structural & molecular biology, 27(6), 550-560 (2020-05-13)
The interplay between E2 and E3 enzymes regulates the polyubiquitination of substrates in eukaryotes. Among the several RING-domain E3 ligases in humans, many utilize two distinct E2s for polyubiquitination. For example, the cell cycle regulatory E3, human anaphase-promoting complex/cyclosome (APC/C)...
In silico APC/C substrate discovery reveals cell cycle-dependent degradation of UHRF1 and other chromatin regulators.
Franks, et al.
PLoS Biology, 18, e3000975-e3000975 (2021)

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.