opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AAAGGGCACTGCAAAAATTGAACAGAGGAATCCCAAGGAAGCTGCCTGAATTTGCCTGTATACTCTCGTTCTGCGACTTATAAAGGACCAGACAAATCAAATTAGTGGTTTTGGTTTCCGCCAGCTGTGGATGCCTTTGACATTATGACCGCAGAGGATTCCACCGCAGCCATGAGCAGTGACTCGGCCGCCGGGTCCTCCGCCAAGGTGCCCGAGGGCGTGGCGGGCGCGCCCAACGAGGCAGCACTGCTGGCGCTGATGGAGCGCACGGGCTACAGCATGGTGCAAGAGAACGGGCAGCGCAAGTACGGCGGCCCACCGCCCGGCTGGGAGGGCCCGCACCCGCAGCGTGGCTGCGAGGTCTTCGTGGGCAAGATCCCGCGCGACGTGTACGAGGACGAGCTGGT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

human ... RBM47(54502), RBM47(54502)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Pan He et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 23(3), 181-189 (2019-05-14)
Curcumin, an active ingredient of Curcuma longa L., can reduce the concentration of low-density lipoproteins in plasma, in different ways. We had first reported that curcumin exhibits hypocholesterolemic properties by improving the apolipoprotein B (apoB) mRNA editing in primary rat...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.