opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGTTAGTGGGAGCCACAGAGAGGAGCCTGCCTCTAAAGGAAACTCTCTGCAAGTCACATTCCCCAGTGAAACTCTGAAATTATCTGAAAAATGTATATAGTAGCTAAAGGGGGAATCTTATAAAATCCTGTGCAATAGACATACATAGCTGTACTCAGAAGGGCTGTCTTCATCTGGACTCCCACTAGAGAACAGGCGAGCTCCTGAGGGCTCTCCAAGGCTGCAGACTGAGGTCCTTGAGTGCCCAGGCTTGAAGCACATTGGCTGTCATTCTGATGTGACTCGAGATTGCAGTTGCAACTTGGCAGCTTTTTTCTACTGGACAGGAAGATGGCAGAAGCTACGCTATTGTCATAGCAAAAGAGCTTTCTATTTGGCACATACCAGGGGTCCAGCTACTG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... PTGER4(19219), Ptger4(19219)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Dingzhi Wang et al.
Gastroenterology, 149(7), 1884-1895 (2015-08-12)
Inflammation may contribute to the formation, maintenance, and expansion of cancer stem cells (CSCs), which have the capacity for self-renewal, differentiation, and resistance to cytotoxic agents. We investigated the effects of the inflammatory mediator prostaglandin E2 (PGE2) on colorectal CSC...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.