opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCTGATGAGACCGTCACTGCTAGTACACAAGCAGACACTTTCACTCCAATCGTCCCTACAGTCGATGTCCCCAACGGCCGAGGTGATAGCTTGGCTTATGGACTGAGGTCAAAGTCTAGGAGTTTCCAGGTTTCTGATGAACAGTATCCTGATGCCACAGATGAGGACCTCACCTCTCACATGAAGAGCGGTGAGTCTAAGGAGTCCCTCGATGTCATCCCTGTTGCCCAGCTTCTGAGCATGCCCTCTGATCAGGACAACAACGGAAAGGGCAGCCATGAGTCAAGTCAGCTGGATGAACCAAGTCTGGAAACACACAGACTTGAGCATTCCAAAGAGAGCCAGGAGAGTGCCGATCAGTCGGATGTGATCGATAGTCAAGCAAGTTCCAAAGCCAGCCTGGAACATCAGAGCCACAA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... SPP1(20750), Spp1(20750)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study...
Karl Blirando et al.
Digestive diseases and sciences, 60(6), 1633-1644 (2015-01-13)
Radiation damage to the normal gut is a dose-limiting factor in the application of radiation therapy to treat abdominal and pelvic cancers. All tissue cell types react in concert to orchestrate an acute inflammatory reaction followed by a delayed chronic...
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)...
Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell...
null

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.