opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGGATGTGATAGGCCAGGTTCTGCCTGAAGCGACGACGACAGCGTTTGAATATGAAGATGAAGATGGTGATAGGATTACAGTAAGAAGCGATGAAGAGATGAAGGCAATGCTGTCCTACTATTATTCCACAGTAATGGAACAGCAAGTAAATGGCCAGCTAATAGAGCCGCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCCGGGGAACGGAACATACATGGCCTGAAGGTGAATACACGGGCTGGGCCATCTCAACACACCAGCCCTGTGGTCTCAGATTCGCTTCCAAGCAATAGCTTGAAGAAGTCCTCAGCTGAACTGAGAAAGATACTGGCCAACGGCCAGATGAATGAACAAGACATACGGTATCGAGACACCCTTGGTCATGGCAACGGAGGCACAGTCTACAAAGCACATCATGTCCCA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Certyfikat analizy

Świadectwo pochodzenia

Shigeru Amano et al.
PloS one, 10(4), e0125054-e0125054 (2015-04-18)
The MEK/ERK pathways are critical for controlling cell proliferation and differentiation. In this study, we show that the MEK5/ERK5 pathway participates in osteoclast differentiation. ERK5 was activated by M-CSF, which is one of the essential factors in osteoclast differentiation. Inhibition...
Shoichi Kaneshiro et al.
Biochemical and biophysical research communications, 463(3), 241-247 (2015-05-23)
Extracellular signal-regulated kinase 5 (ERK5) is a member of the mitogen-activated protein kinase (MAPK) family and is activated by its upstream kinase, MAPK kinase 5 (MEK5), which is a member of the MEK family. Although the role of MEK5 has...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej