opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGATTGGAGAGGGTGGTTTTGGATGTGTGTACCGAGCAGTCATGAGAAATACTACATATGCTGTGAAGAGACTGAAGGAGGAAGCTGACCTAGAGTGGACTATGGTGAAACAGAGCTTCTTAACAGAGGTGGAACAGCTATCAAGGTTTCGTCACCCAAATATCGTAGACTTTGCTGGCTACTGTGCAGAGAGTGGCTTATACTGCCTTGTTTATGGCTTCTTGCCCAATGGCTCCTTGGAGGATCAGCTCCACCTTCAGACCCAGGCCTGCTCCCCACTTTCCTGGCCTCAACGACTGGACATTCTTCTGGGCACAGCCCGGGCTATTCAGTTTTTACATCAGGATAGCCCCAGCCTTATCCATGGAGACATCAAGAGTTCTAACGTGCTTCTGGATGAGAGACTGATGCCCAAGCTGGGAGACTTTGGCCTGGCTCGTTTCAGCCGCTTTGCGGGGGCCAAAGCAAGCCAGAGCAGTACTGTGGCCCGGACTTCCACAGTTCGAGGTACCC

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... IRAK1(16179), Irak1(16179)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response...
Zhen Ning Wee et al.
Nature communications, 6, 8746-8746 (2015-10-28)
Metastatic tumour recurrence due to failed treatments remains a major challenge of breast cancer clinical management. Here we report that interleukin-1 receptor-associated kinase 1 (IRAK1) is overexpressed in a subset of breast cancers, in particular triple-negative breast cancer (TNBC), where...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.