opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACAGCTCCTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGCCAAACCACCAAAGGTGCCTACTCACTTTCCATCCGTGATTGGGATGATATGAAAGGGGACCACGTCAAACATTATAAAATCCGCAAGCTTGACAATGGTGGATACTATATCACAACGCGGGCCCAGTTTGAAACACTTCAGCAACTGGTACAGCATTACTCAGAGAAAGCTGATGGTTTGTGTTTTAACTTAACTGTGGTTTCATCAAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCACGTGACTCGTTGTTTCTGGAGAAGAAGCTGGGGCAGGGGTGTTTCGCTGAAGTGTGGCTTGGTACCTGGAATGGAAATACAAAAGTAGCCATAAAGACCCTTAAGCCAGGCACCATGTCTCCGGAGTCCTTCCTGGAGGAGGCGCAGATCATGAAGAAGCTGAAGCATGACAAGCTGGTGCAGCTCTACGCGGTCGTGTCTGAGGAGCCCATTTACATCGTCACGGAGTACATGAGC

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... FYN(14360), Fyn(14360)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is...
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present...
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.