Wszystkie zdjęcia(1)

EMU058151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk9

NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

forma

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACAGGACCAGTGGAGAAGCCACAGTAGCTGCTGCCATCTGCTGCCGGAGCCGGCCTTCAGCAAAGGCCTCCTGGGTTCAGTGACAGCCTCAGGCAGGGATGGTGCTTGAGGCTGGGTGCAGAGATATGCCTGCATGGCTCTCTTGTAGCCAAAGGTGGGGAGATTCTGCGTGGGAGAACTTGGTGTCTCACCCTGGGTACCCATTCCTGGTGTATGGAAGCACCTCCTTCACGGTCAGGGGGCCTGTGCTTGGCTTTCTGCCATCAGACATTAAGCTGTAGCTGGCTCTGGCCAGCTGCTCCAGTGTACCAGAACCTGAGGATGCTCGCTGCAAGGCCTCAGTTCTCAGGCCTTAGGGTGTATTTGTCTTTCAGGAAGATCATAATGGACAGAGATCCTTGGAGGTTCAAAGACCAAGTACCAGACTGGAAAATTGAGTCTGAAAGCCACAAGGACAGTCAACTCACAGCCAGCTCACATTGCAGACACCATTTTGGGCTCCCTGATTAAATGCAGATCAGTTCTGCACACCTCCAG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

transport

ambient

temp. przechowywania

−20°C

Gene Information

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Certyfikat analizy

Świadectwo pochodzenia

Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej