EMU086651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd82

NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCTGTGTCAAAGTCACCAAGTATTTCCTCTTCCTCTTCAACTTGCTGTTCTTTATCCTGGGTGCTGTGATCCTGGGCTTCGGGGTGTGGATTCTTGCAGACAAGAACAGCTTCATTTCCGTCCTACAAACCTCATCCAGCTCGCTGCAGGTGGGGGCTTACGTCTTCATCGGTGTGGGCGCCATCACCATAGTGATGGGCTTCCTGGGCTGTATCGGTGCTGTCAATGAGGTCCGCTGCTTGCTGGGTCTGTACTTTGTCTTCCTTCTGCTGATCCTCATCGCACAGGTGACCGTAGGGGTCCTCTTCTACTTCAACGCTGACAAGCTGAAGAAGGAGATGGGGAACACAGTGATGGACATCATTCGCAACTACACTGCCAATGCCACCAGTAGCCGCGAGGAGGCCTGGGACTACGTGCAGGCGCAGGTCAAGTGCTGTGGCTGGGTCAGCCACTACAACTGGACAGAGAACGAGGAGCTCATGGGCTTTACCAAGACCACTTACCCATGCTCCTG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Certyfikat analizy

Świadectwo pochodzenia

Qing-Hui Zhang et al.
Digestive diseases and sciences, 60(7), 1967-1976 (2015-02-06)
This study was to investigate the effects and mechanisms of miR-362-3p on regulation of gastric cancer (GC) cell metastasis potential. We detected miR-362-3p level in GC and adjacent normal tissues and investigated the relationship with clinicopathological factors. Next, we analyzed...
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej