opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATCTCCACGAGCCATACATAAACTACAATCATCTCAGGAAAAGGGGTTCCCCTTGCATCATATCTGTCCAGGCTAAGGATTTGGTCCTTCTAGGTTCTACTGGTCCACCAAGTATAGAGAGATCCCTGGGGCCTGCAGTTTTCCCTCCCTCTTCAGAAGGGATCTCTTGGCAACAGAGGTAGCATGAGGCATGCTCTGCTTACTTTTATCCTTAAAGGCCTTTCAGATGCCCAGAGTCTGTCTGTTGGTCCTGAGCAAGCCATCTTCCAGATGGGTCCACGTGGCCTTCTGACTGCCATGGCCTGGCCCTCACAGTGTCTCTTTCGGGTGGTGTTTAGAGTGGAATTTGCCTCGTCTTCTTAACCAGTTCCTGTTAGATCCCTGTGTTTTCTCCCTTCACCTCAGAGACAATTCTTTGGGCTGGGATCTCGCCGTGTCCCTGGGTTTCCCTGGGTCTTGGTTTCATCTTTCTCTTCACAGAGATGATTTCAGTTTATTTGTGGCCTTTCTGGAATGT

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... GULO(268756), Gulo(268756)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Anke Nijhuis et al.
Clinical science (London, England : 1979), 127(5), 341-350 (2014-03-20)
Intestinal fibrosis with stricture formation is a complication of CD (Crohn's disease) that may mandate surgical resection. Accurate biomarkers that reflect the relative contribution of fibrosis to an individual stricture are an unmet need in managing patients with CD. The...
Quentin Lepiller et al.
Journal of innate immunity, 7(5), 530-544 (2015-03-21)
In patients with hepatitis C virus (HCV) infection, enhanced activity of indoleamine-2,3-dioxygenase 1 (IDO) has been reported. IDO - a tryptophan-catabolizing enzyme - has been considered as both an innate defence mechanism and an important regulator of the immune response....
Norbert Braun et al.
Scientific reports, 5, 13450-13450 (2015-08-26)
Tumor cells can adapt to a hostile environment with reduced oxygen supply. The present study aimed to identify mechanisms that confer hypoxia resistance. Partially hypoxia/reoxygenation (H/R)-resistant proximal tubular (PT) cells were selected by exposing PT cultures to repetitive cycles of...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.